ExifII*7/5KS(1$[2;lzflzfi% 4woman backpacker enjoy the view at mountain peak cliffCanonCanon EOS 5D Mark IIIg5'g5'Adobe Photoshop CC 2017 (Macintosh)2017:01:04 15:45:12%V^"'d02d0230fz    000000010001 245 ? 2015:06:03 08:25:402015:06:03 08:25:40`W:158027001783FEF24-70mm f/2.8L II USM2210001535(HH Adobe_CMAdobed            k" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?DwkBTf`AQVX<i4Ω۬̌r-*ʧ{ }[:_^jӞ{{Hps\6Vo%v ^!}_NO?Xd.͍L?$I$PI%)$IJI$R'I%-#H 'TT9YU[{{S F !f}iWk<ۅG|+O!TtvR7ĖRA~|mh+{ŌqPsp2n]9՚hvx>3g54VMs?酱[2zUIcluOnwn~k[V7-xDEͿ/7;841;ѯEMl˲ŒGI%#I$I%)$IK%0{ OUr: m7p字a^h* ˢW?~H#Q}Gk\Tsq / 'h {'ݩwpx8܍k4W?g}u596$71'ٿl~jxMaD{ukCnͿMDG`zXsoz\@s}/.=KVmvoւ?Gsw>X]Xs-2Y;\֖ۣWu'VzQ6)a;k1aJϥ!tNέC$cWO,v[h{}#Gbӯ.iccG9In:}ͯ(}qtGDKZR>[ i(B5^Ο5m8VkI>7g#clDxyW/5,CnaIn̐=}'3 E@KXKkOMf^qyIW'WU5דS\XF͖w5:H<2%~,f%jE]1 Bi6p@Gt/T{H.-kt 9Ud}ʽ[|ru[>gÏIzklG$T.[o)X&C]?(;!btK~{s;#5i?rnPS*v^8DE+d\LP<̣\5 $˹yOD٘V7fh ʇ#ن^I|R63vڙ]Af`]p?Gl{CoX 48PK}=ڜjlrmUtgML= Flm߫fŹ>}UEs]v+[cskouz]k̸8OnVOV?Ԇ\׌k^'?OIy6%01pa2vd4U9$^YsٵsSgH]SC~ͦUK?quUS5%Cм뫭w\5MuTCm{wӯc(,pcPBnm2$sKtѐ\=Gm ]r2K/,KRf5̿'өPO}2寮-Wٲ N ;;8ǪqcpφGRlpch mkS}~{=?GI鬛\Km[oߑa$&6 :Z @<4Ϳz^?G^O]{1=]<'786CU>Ƹ4UVfMpnZz&NIG)Mh>a#0hl|?uW$ w{rg^5Аy!YvZX0V{?6?pJvg{ 꺽AeMeS9 s5Xv[w9sZ/2nS sdH[4-ݳwldpE9As}k&LzY>C\G_6]4n3۶T}?eեK:-}ZOH!IE!՟0qFcN*:_,TUzFv+*HDo5}O+}#"nʅkwcO{«/aU:fMuQ ՒF>=K_S:&[}_h[7]e݋e*܎f5x{=mb_Ry8_4ehO԰G]"}]ls1UbqʥKt#oeݳoۋ]60_ijgG?v,|MVVHh{_VߠkO|uaeƺLٽߚz{..D׍ߛn_]{^q>wETi( K 1hen{aH \N5sF~B{Pd t:~c!^ VH s x|~,MX~ނlDnӫFvA$(٨l~~?6S[dwlŕY]\߳Zv6f5칕WMf16>r*^[G}ȫֳ'7Pc ]lA/c[s7.#[,獍~OU2}07Um `3ss;ʘp/F3Zm\58hd.V:NPlͻ2wj#k]~w]l:hkO*z1;wzjZ = <Ҭ/8op# Y[Y\?S_M鶟]:͝3 'ݲ疜۟ˎXˮ̋2EFϲeFӾVZ6;fO~z>ՇnݻCww?G*l2/# ~e1;1cmunƺ_M666YeL߬9uC_jeV>?nOcl ?GCO ~;~7OOC鼖b&O|4Kۋ*'?0` aq'elm5W1s'6:+;z\z`,KMh?7vzϟW}ͻӏSOwga"k[`Q|qo[a۵l Ulj?:Dфq˨gup==m},w^8ziRO'7O{=IPX},6Io?_O֏#_f;`>46:kZֿX=olnǴ;V5>P;ocz[?ٳ~K_߻g?Wu;#XgvO翡~m?/!iU2NG1XokSwTuJnCkU~pq]V[ClgM 7xQ[}/S/ӯz>}]j{?=O~?bw}ԍ7~mE¤d5P?$Photoshop 3.08BIMZ%GZ%Gx6woman backpacker enjoy the view at mountain peak cliffi6woman backpacker enjoy the view at mountain peak cliff($Model and Property Released (MR&PR) PlzfU ContributornGetty Images/iStockphotos iStockphoto 477296944720150607< 082540+0000 Backpacker Vibrant Color Retro StyledTravelStone - ObjectMorningOne Young Woman OnlyFemales Copy SpaceBeauty In Nature Gold ColoredPonytailBackpackSittingRestingHealthy LifestyleChinese EthnicityAsian EthnicityAsian and Indian EthnicitiesSuccessJourney Relaxation Enjoyment Confidence Adventure ExplorationBrightYellow Orange Color Green ColorBlue Black Color Old-fashionedNatureOutdoors Rear ViewHiking Black HairTreeSunlight Rock - ObjectCliff Mountain PeakMountainForest LandscapeSkytlzf8BIM%Vnn̬e4gP8BIM: printOutputPstSboolInteenumInteClrmprintSixteenBitbool printerNameTEXTprintProofSetupObjcProof-Einstellung proofSetupBltnenum builtinProof proofCMYK8BIM;-printOutputOptionsCptnboolClbrboolRgsMboolCrnCboolCntCboolLblsboolNgtvboolEmlDboolIntrboolBckgObjcRGBCRd doub@oGrn doub@oBl doub@oBrdTUntF#RltBld UntF#RltRsltUntF#Pxl@u vectorDataboolPgPsenumPgPsPgPCLeftUntF#RltTop UntF#RltScl UntF#Prc@YcropWhenPrintingboolcropRectBottomlong cropRectLeftlong cropRectRightlong cropRectToplong8BIM^^8BIM&?8BIM 8BIM8BIM 8BIM' 8BIMH/fflff/ff2Z5-8BIMp8BIM 8BIM8BIM0 8BIM-8BIM@@8BIM8BIMiThinkstockPhotos-477296944nullboundsObjcRct1Top longLeftlongBtomlongRghtlongslicesVlLsObjcslicesliceIDlonggroupIDlongoriginenum ESliceOrigin autoGeneratedTypeenum ESliceTypeImg boundsObjcRct1Top longLeftlongBtomlongRghtlongurlTEXTnullTEXTMsgeTEXTaltTagTEXTcellTextIsHTMLboolcellTextTEXT horzAlignenumESliceHorzAligndefault vertAlignenumESliceVertAligndefault bgColorTypeenumESliceBGColorTypeNone topOutsetlong leftOutsetlong bottomOutsetlong rightOutsetlong8BIM( ?8BIM8BIM ,kȠ Adobe_CMAdobed            k" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?DwkBTf`AQVX<i4Ω۬̌r-*ʧ{ }[:_^jӞ{{Hps\6Vo%v ^!}_NO?Xd.͍L?$I$PI%)$IJI$R'I%-#H 'TT9YU[{{S F !f}iWk<ۅG|+O!TtvR7ĖRA~|mh+{ŌqPsp2n]9՚hvx>3g54VMs?酱[2zUIcluOnwn~k[V7-xDEͿ/7;841;ѯEMl˲ŒGI%#I$I%)$IK%0{ OUr: m7p字a^h* ˢW?~H#Q}Gk\Tsq / 'h {'ݩwpx8܍k4W?g}u596$71'ٿl~jxMaD{ukCnͿMDG`zXsoz\@s}/.=KVmvoւ?Gsw>X]Xs-2Y;\֖ۣWu'VzQ6)a;k1aJϥ!tNέC$cWO,v[h{}#Gbӯ.iccG9In:}ͯ(}qtGDKZR>[ i(B5^Ο5m8VkI>7g#clDxyW/5,CnaIn̐=}'3 E@KXKkOMf^qyIW'WU5דS\XF͖w5:H<2%~,f%jE]1 Bi6p@Gt/T{H.-kt 9Ud}ʽ[|ru[>gÏIzklG$T.[o)X&C]?(;!btK~{s;#5i?rnPS*v^8DE+d\LP<̣\5 $˹yOD٘V7fh ʇ#ن^I|R63vڙ]Af`]p?Gl{CoX 48PK}=ڜjlrmUtgML= Flm߫fŹ>}UEs]v+[cskouz]k̸8OnVOV?Ԇ\׌k^'?OIy6%01pa2vd4U9$^YsٵsSgH]SC~ͦUK?quUS5%Cм뫭w\5MuTCm{wӯc(,pcPBnm2$sKtѐ\=Gm ]r2K/,KRf5̿'өPO}2寮-Wٲ N ;;8ǪqcpφGRlpch mkS}~{=?GI鬛\Km[oߑa$&6 :Z @<4Ϳz^?G^O]{1=]<'786CU>Ƹ4UVfMpnZz&NIG)Mh>a#0hl|?uW$ w{rg^5Аy!YvZX0V{?6?pJvg{ 꺽AeMeS9 s5Xv[w9sZ/2nS sdH[4-ݳwldpE9As}k&LzY>C\G_6]4n3۶T}?eեK:-}ZOH!IE!՟0qFcN*:_,TUzFv+*HDo5}O+}#"nʅkwcO{«/aU:fMuQ ՒF>=K_S:&[}_h[7]e݋e*܎f5x{=mb_Ry8_4ehO԰G]"}]ls1UbqʥKt#oeݳoۋ]60_ijgG?v,|MVVHh{_VߠkO|uaeƺLٽߚz{..D׍ߛn_]{^q>wETi( K 1hen{aH \N5sF~B{Pd t:~c!^ VH s x|~,MX~ނlDnӫFvA$(٨l~~?6S[dwlŕY]\߳Zv6f5칕WMf16>r*^[G}ȫֳ'7Pc ]lA/c[s7.#[,獍~OU2}07Um `3ss;ʘp/F3Zm\58hd.V:NPlͻ2wj#k]~w]l:hkO*z1;wzjZ = <Ҭ/8op# Y[Y\?S_M鶟]:͝3 'ݲ疜۟ˎXˮ̋2EFϲeFӾVZ6;fO~z>ՇnݻCww?G*l2/# ~e1;1cmunƺ_M666YeL߬9uC_jeV>?nOcl ?GCO ~;~7OOC鼖b&O|4Kۋ*'?0` aq'elm5W1s'6:+;z\z`,KMh?7vzϟW}ͻӏSOwga"k[`Q|qo[a۵l Ulj?:Dфq˨gup==m},w^8ziRO'7O{=IPX},6Io?_O֏#_f;`>46:kZֿX=olnǴ;V5>P;ocz[?ٳ~K_߻g?Wu;#XgvO翡~m?/!iU2NG1XokSwTuJnCkU~pq]V[ClgM 7xQ[}/S/ӯz>}]j{?=O~?bw}ԍ7~mE¤d5P?8BIM!]Adobe PhotoshopAdobe Photoshop CC 20178BIMhttp://ns.adobe.com/xap/1.0/ 477296944 Backpacker Vibrant Color Retro Styled Travel Stone - Object Morning One Young Woman Only Females Copy Space Beauty In Nature Gold Colored Ponytail Backpack Sitting Resting Healthy Lifestyle Chinese Ethnicity Asian Ethnicity Asian and Indian Ethnicities Success Journey Relaxation Enjoyment Confidence Adventure Exploration Bright Yellow Orange Color Green Color Blue Black Color Old-fashioned Nature Outdoors Rear View Hiking Black Hair Tree Sunlight Rock - Object Cliff Mountain Peak Mountain Forest Landscape Sky lzf woman backpacker enjoy the view at mountain peak cliff lzf xmp.did:5be5e3f3-ae40-444f-9fa7-b753debca001 ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,ICC_PROFILE @$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^uICC_PROFILE `dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<ICC_PROFILE bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{ICC_PROFILE        # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrICC_PROFILE qqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJICC_PROFILE Ӗǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpICC_PROFILE aRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$'jٹ'5^F hxcqnPbc1"Rrpc'Ik_wq7CUr{2*a48n T16PB0"\oX1bNqA( ʛb LldLυG>Mr÷1u#Vكxqp5M2"0:y3៷c;M[M><8G5&D O!AQc ݌,!>1aȞ^~hd ,Lk)S|b|?Uo۔ c  P\p [A A`0nb 1b_ 00Ac\c0`k0A  )b`0A A`۠0`10A d br?uG x*`cAcYV   0`   0` Vm=V S `0A f0cA`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A* ?0Ddœ)k:C/Gg\yyW' dWs8x}ԤBu3ݛ e  fgc U!a@ 81cCS3?n1XPd)Ɛb?ob7{Ny[lZ~X2)M iN qx xE#ze-?t`7S>Y\n!BtÍ0A A`0A A`0A A`0A A`0A A`[N~Ƹ^JM25h$úRۮ glUMys'se`œ*(05qwQN7!5#A,kBG3J' \9$Oǔ xg<30k#/ )C@i2x3 L+O )LؙȞItAQLxV3,`ſv3Am7Cw'A3'pv4S LK Ͳd=(HZ#(U$pxFT1 \Ih@xP`Kt(AQuO81n~,(=@xNbZs-|1(yS,e0Z)OO1hky5Q, yl r¦m<7~N:Kdxղ: mJS1cN^ӌnl(2&#ȊoRNRNWnb UT bRʂe>1L'9x)ZA,֠{3̭; Ӈ0FY` iqp<̯ve0^)Qhk,&^0(MF|Aߌ@IR|XW`/ k=1qFYuȯʳBR1pF`@`ǻ <=`<`0`  `A`0A bx#33'b*{1 x1Pbe#E#EBctk^?,mHDSy%XPÌȃkBfRť?dNO,Zcu!I]Apz]mDƇG,daXtIWSA T38bS0cV-P|>UqӆCك=$YPSZQ9fxƤLN#T ϼ1*P4$)jz=p>`J_|48xgꌁ jxs/qq`0hO Z[Yo,J> kN'020|C_8 >2 eZ2Rrܩ1|@cS0`ҔJSX*CH9۠9~$H _@*xgFcl!@Z-噠Εe#4v55S¾`)@} [Ç3܃AT!ˍ}tdK۶ TSU0&cŠ3|]tAgO\!0cMMy@q}X8K @Ua9|I-pRe9HS c&NbWJʂ@"!\)._u)Lbt ZKu-EOF_o$7A$JkBhA ̙pG٘ʇ) SUE>Sǐ_.1>ݻ#9iAj30T:j:jˇR ZhUC\X+(@CJ&Q ?-kP3|AL`Au/Ƴ1P)" \2A&=Ìp ZkV>4$x{  @0% C^A`!Tc,dm(`+F|9r3.S>ī81kOx1BOZ0pN"8 Ic Xµ5m5<~hDch12s߅Ar*rʪxI\^b1cPT@d9T1!XȜ ]*kZ yaICM wq+:lW8g `A OhG!~1jOV1MjAp 1KYW"T*pNpoJDZrSϏX1^.Ddctf gZ14 cbBr:LHETJKS*c3p)wAxo0 01C0` aUjr7F"kṗu><(0V`FY<%H1P=€E6XA0A A`0A A`0A A`0A A`0A Ac23IPxEZM@OL̴6/yDdAv`G9Ps $nmb&¹x\ ̥Hp8W1ƞaʽ< Ň/68AAqDc QJ`I'*F|0J2T%2}bl.R ccS\l fT(kJs8$Rx<5&!nA==¢G1Z 18~1 _1MyF% Pc%d2#/ mAHHQ+p@)\֠!'% R)1\,p ZAS\H&Ϟ 3?Z}Ħ!@疪;~0b5΄ᘨe0Ubzi N^SN ec.c~0~cL2 p;4OL%3* Dz QI"|(2(ևZ~#Tӄ~cIW ; gO'1,ĜchlT_Î3YƞLZ򧏶# bQPI8)g)#|e-&3hNj)08AtAr (8|ok)ưb#3)\Lb   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`    A`0A AR   L1e}aƧ,zAƻL2"9gOMpP&pC ';K!K|m %RθH$Hxay ̰c )_ۄ1Z3#y+)Ɛ`̌0F: ŝDէXi6ʩNP|G8j#-.U+Pk\br3yӔϖ(>~2LcD$AI:Άdq0% /Rk3cRd 03H\{=*=pM-ŸGׇ)p|Ҁqik>Z*76 Xq{~*G-RA@11< jO|$e>֙ J5Rp?n1(تb Z=~"5rdHmd BjT3X1q"I0`h"[S %jiJLT? ָ)Þc͍.QoВKPROコF: ԩ$S<K~0Ai?/'Uui\k9d(O iqs< _1y/76iQ)Z֧֠$ITO-`ִ"N',QF]c!9TST *x3LXEKJ1 WZVM9 pLo@}bxO>X08Q81PyeS`e c,@ j} `TBKR& ը|^> 4lt,gQt# Hk. Z@<+_sV y{sx'6 ٓ*Tq52T9S(XRWU9ƅɪj q>\(";X0ԓ XoOW caQe01(11M-!Bւ2$*lD,Pq>1ݍAJQ1f'p@?->A֣1s*GQ5$2D0AH $F0A*/><=0kjSQbi>1wW=5bcJNq1SpLb j+~#20AcH1 pb *A 1( N0`0A0cAW|`0A&0cX 0`   p#`& 39qUcX 0`  2'|`  0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   1Pyil[<瀈 xcDl\ǎb同=#Q%mdȲp·e.XЦmۻtϪ>>RaaG3-Pg7̔z!yMjU3}8t`)稊ݍ! b=01'-86 pOdv @׉>TCqN ce`O:/8Aqm܀qŤ9ymBs-cCC(0`   0`   0`   0`   0`  +S"q d=qIz ^@T}ʳ|ɤ&{pk?82pb˗ ` hsSw(1JD '# X_,Z^Cٍ/xi [d!<-cH0`1p9cpftg.&yRn1FsFیM$81PM(ueq8S"6Rʩӷ`ӕE3 $O.=b raJr  DnSLx8 !&d0` ljqqf;cxF V8(9gFS1LZण_m80`, |isS0iAA?|@<`ex 17rχۃ|` +Ͽ F +)Lwwa 0eLN Wfp`xAS`J݂0 ^gX bf4||1С*F 8H N-ώ3HҸٌsc1´ω^>xdA,f0f 1 A`$p 0F 2xAb   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   3*OqHA&&e-b 0`9:`pbN|xlω˅|O݌Q d]Ij'.(p am=/1+kB`\i }B Vn^9`{k\YiZ1p]TcRePbãIFq)D>\efAo?nnWbUɳe,!BKqJ)L$ˇ(1Bj}1)R]M?,Jod ۪ aJֺiOمS3 n巌{ ,jhH9b1a!:̜`Qݖ7 񆫼3A-F. Qic"5\s w(3>}G݃ cQY ^iNPH0bR<Љ4Ӿ c&8p cǏ X:c0aB.~q1PyŸ ' n5 Fz`c$t$p,AѱA"8s8f dK*h@L1J1 W5SG12A1 `(ʄ9>x+bFS ō@(⨥8g cS #,Ҁ~o &6APf c* 0F uRX{q +1lPrљ}v0cG%n gȚ##3(1~hu?31y;۠5 y INY(Spb~ *(sז_ad0WUӅk}n;07G|*\JUS,o1cOq1Tn&`8 g(jG,_6T281uJȓL9LuM{keXJ)!)qҐ;{`Ť+r\@ 9{2Lb0gxf0A0W|`$  A8A)A c0c8 + S  2jA x "0cA`0A dp \NSi>sOw )LJAg ) )Dbj f A 0c ̌1 M((3Nyc)R1L`  0` `0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`# f dsSDPS rNRaNӦ`µ!ʜμHA`i.P*N8Ԑ!D%j2AxN1_120bjT HF)* WQNCt$Vx=bIp *1B*3E4B PX#H0 w`p@ij`1`k@ģl:{Ř W0F ; TѽecRH0j<92ƕ.)W^'#ʩfݵ`A.j<=<(T\3bӒqF1Ok`8p0F1S<3b64@2e pbibe+Lgvt\*93NM~m*BEsT+i# &x`Ab)ưb!DA`A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A Abݟ1V S`xeXmQC)ư`0A A2L1 A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A.N0i= ,R6 Ŧ#2?J :b 2bs  pb)?JHʰbsp 2 @ȪǍ)C4$p-B0"Џ.Fx*Zp5F2R|=0aGF!pu񇿵34 LV BϯS8KnqT6SA<cj]y~ydz 'NTݕ8sAVum*\1je S2D6@X`>2Qť0̆R i( 啨iϫw-iJPȞf207BK-ÎK&VqpsJ7q>f5 ZYiǗ s Jh+1y1F^ *E ? eI ᷾ 8;`n0b~?n6+I9wFVS>wA?N1I2qδȌfD\ $5VpbW_ݍr31.M9~dV0gxcX` uϝkZrn3h1zeLNdWEc)Dx qABsᄩ e) Pk9V2k:  I"Q(ɡ+LC\l̼pԭ%=`4]^ 3$cUWtJP46ׄ )"ZS30cQ(ƾ4<8e0YIf2351vBopH1L]xxgȠFgF1R?~<2R [/c&1n -h8W!R`W"F81}JԊq Iʿ6-0N UH%J>#/ߌ LAֿ,z` s10c10 jAsPoiƦ ]^A_C8AmQ yk +#" [c0`W<<`Ş:q)1 A|*GNU3'` c.u9c"1-$A}8c_}nM$AE\?lJ D*@$e31nmZ529|MzqF`E'5}@ê0qU`*2WL3'(1BZξ4˖ &*2vl#fir |-ιҀg^<1NJS0 6R5ds@85"F48Lڼ44)<2:LIƤƄ <urpsb13XA[Of<<xܕo֠M c- i k9RJL1>Xq0ANT$x4ՅSIł(ݍwB``_h<*%DԒ1k6^ҼqcU ;ƍOO–U*4‡5f%( Z  dWT Vy(I·:?'f$H6dp9Q`Tf 0R6)TЕ-O݌*N%C ;ŵ"Z\cf`T$ 0E0b WQ#T*|&Y J c 10` \M q [ `f S8 b0cA<  k0A Abž/Äb k )DĄbJ3 d &eɜ#xDF qq0ANA gOD VX`g-Ƒ0` T׍(ݍ S s*0cX 0A   0`  PA   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`  FpaJiĚd֋O 1hl5P3(.3'!D Q T08FR*2NU(8& Ps̄jV`_/`u %Pbk. |qP-\`&g# oC(00A A`A380`A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`S#a*Lc1=ܽ#|e-cH0`   O?ØT3`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A Aq04`_t݂m W9'&PbdZg:`$8b,ѽB<)JP{~% \xF17 ~"XЎ0+~+aR$1T Wɷ_1mg<{(qqx d_Wc_8[{tU|F6YOW;*ʞd#gChκJ RM:ۦx jF(^pbUd p*1*҃_Ԟ|)9c Tb~12yS(*Ef5Bb2q)ƴ+Zxu2vm jBv#4ЃJ~=>|qvAts_ߍr"P`"45q!v/Uc3dUX~R YL2dadѾ;J V4SGe,hyOܿ~3#2L 0`   0`   pA   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`  +1QTˑH48+a|=<=T~8̣P>0c(r9W>9 a]"Ϧ TΦW0H2>j`-|s·11rfD~@XԻ-f<)@,Д0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A Ab?ٌJ6`1   :T',k  $A8`v2ʵG~ ?e=#t@wAQ#,FB$H1M^rC(r _\3BF 2'?Db`L1_eOق3 SL?gh0F$V  0FčbΕVW߃tYzAA^x#2Nbf'80{8c;< A3"F6Jg1By+Q\tM9s>`R<%``㌐cD81Prd*W` /(`,o O`a+8 A{yW7 Sb   kģl 1   1S3 0`   0`  2 0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0` ) W%81Lt1Z_Fg^0bbp`{Gc1ˇ81n3b   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0` \T030 + )1n3 `0A A \W.9c )`~b29`s,1'-_ۗ Hrg,l)^ygay.yLk*pla$K9Tx);.?g˕pcd59HT9hV{V 9v8j'ؗ'LJpSܣmdJXBEt/*W`-ykJVPA"2ɑݻBs,)Kr8-Nypka+< 7\9eNxX (rŸ\1e<*}E*LXu/F-2(^k/adHΞXE0I0YAuc9vCȮYc0ϗ'獤Hx0b%kyH7k\e(M9Oܼ3 ]A4@/aiJN/fՃ l̸<`-1aK X1ij xBjY"{w*~&I1Lf5 0`   0`   0`   0`   0`   0`   0`   0`   0`   0`  ξMFY|}BQ4Ȩ&7Au @ 3k%H `Z=Á: Ӄ&gߌg2/yeAo EF~3('H1mv??aL1j2xXFI;QS.~&p$ L?+%A`ufhxGؤS `͕g9SH$c=1y4 PiN9g\~6 jT'#iQO`#^b(c3<{NR'H0 yO'Y}c'U .& | ˉ9lƪu(5"υ8~5q=>AK$ +8`&q\R;|^uOn|(̀*I#28'81b^QS\d d)ʜx1nI$Σ wqt[R2-` m2$.2 fʜ2ϟˍb Zxp"ӅF5NDsF ?™񪠃9 fs eJjcSbb1: cƇ#_eq` ^T,dL ]] r4ʜـ p   e*|9Q09\_`_2ymLc ZNL*X'9ן><}'21'bbQ)2L1-b   A2-r|t~qPc(4Jߑfe81C@C1N|x P&c|dQ((WZS*݁28QP*MQ c1R49c2(^0.qΣG2jlgA ӆ5j&Jp$JׁD2Yۢ Xi _wkF`d+: $A1+ЂiA*͸1kSNO<0 kOh 1n0`Ɔ3+1ĥP81Z-F *yp΃gA/\Z`+V0f *p>U? Q4gO A)jl: *<}'dS0(Fyg,mpbff0FT? b Z q:cq8 TQPG|q 0bA8A* i̓N0qb"f3+`1c   ` L`( 1`e0 NA W F |?n႕b }8A 5@3 l1*I\ SX:` 0`  5cDbJ1  G<)LHl`9dx`c0A   0`   0c#`  0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`da A ϟۂ  0`   0`   0`   0`   0`   0`   0`   0`   0`   1\M 0F 0`  S ^8Sߌg A9`3!Bb#ጌcE|54 R*F0Vˏ)1Py"6JOtU!2k `W˙ FAs#Q10q4WI Ԝc39BbfbM>ܩZTxcYT)Rg1i>2 )_قQbk*MpFI 1QNxl1  230A A`0A A`0A A`0@ 0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`  ̠M9~n}fR0`c0b#bwc4%)% J #`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A/bC}-4Z{q9V4^\ 1   0` _?ϝN5腌5p.dr&n&N0c%N_wk LOP E#ExĆ0bƟoیN cG92-I}ohU۶ ق9r U<PyW ^*{r)qDJ WQ.8cqUbdjxSZ㍥%U.<`ŭ)_}~`M˂ELn6 q/Ǎj`1pb8ÊAw^ k9xe i8ÄݺA +g,`1iZ3/-|id#3c  1€j`0cu|)FbjJ+uxA9<181Eʠc_q QF$'Q&AR/&qPb̹և"| 2F*>* !Jn+0`X:`P8V)('tZTR8c5Tقr`RLPAx1PMrjxr29 Ÿ  3៻bP7eΞ Axg6H Ŵ$Lf TE<܏)oAu!8S%3L 4tbbs3+ʐAcH '( xA A Atc`wAŸ0N0A?bˆ送:)M`I'N1S0p q  A3$? g|b<9q 0` b  0w11Lj 10A A`0A A`i1`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A.^YҘ))px V`8?(1Nyc1AqP̪B Y(0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   pFk+#Çq'M`xS 8 3f3<0A80`A,bQb* 1Ħ 0`A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A Ac!ScQ<ʂ#hI )`Np,@d08eH0+}#b ?&xC|B SHf1&b3`w*Men1}kSmݰbT5\"pb9XB*$Xc b}4\(*,a80`   0`   1PH5l1{Ƨ,*SO` )?݂1*O\`ca;{c0bg\f1E̊ˉj1s>e,d,Ms*cU&q`%)F`A A (N)1Bc@=>mAPSsj3EbG>U1(ń<#0bR|)IX0ZW0eۈ-cXR0ƤW<$ѓ2̱ɩL)p6@+`*4ι 9&P c|~tʼrZy 0Äf 4~ bb0` 4.n pAX0AQ?1~ Db $ɂ S3 bA`0A A`0A A10A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A Acafbo S`380`AbʞΒ 0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0` V8m>=`scX0>>b3A+~ A-cX1_oۂ k ߷1Ɛb}ԎX#&-cCZ`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`Fߺ S`0`   0` dҼ55&JL0F: ܫ?X~ rJH5-G#J103n~o)w q̦h~j#1A `1h 5c-,{7#0?x"uC1hB   0`   0`   Çc *3FwJ U sdgIB$0Pb 4` ιWcIm2eq\ӣxbR V3ʺ)CVΙ8%Pb[:Stʣ`ON  qRvtbtδ+Aux11CRTa姿0 #h3< -qA-90hh>I10 f Tʭ -J\f1 JPCh3!L *c2ּ-ըIQPkS bEI4{ie*c-X9ҧF4I ^PX+xhMx SXk ?oq#$@~ #|3`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A AbR|+ٍIPyJ Of $Ax{y`V]0b´ |k$eHW1n3 `0A 1`rO;!=+e0r/tԃ f5$xi9bGݕ=\*j9J |3CN|j$H##:c1RDMJ c9҄sHJs.H^uNqqE9~1n3 0A A`0A A`0A A/pÑnRZAO:Z߅A\#SJs1aX1g e\Ƒ0c6Bpc h|֔.tn1ZTE~5n=Qb$0ǖ2mB֕ΜiʠŽ,pr`O 3b9_pʟ0ۢ ]Q1jA Bn9ARiB,_f Ps1A. )ZbAҠy@@o`*xj'QC Px 9j>Z" A!OΘ O b<IAj"$OU0ZWayr<`EB?*U@h+bp`R:(33 cqҞW,P}Ʋm.T<81.-ƅI 1a9֔?1 8fGb`a%N)yBupdHPc0c1`\ gV{8QSDŁ ZV<`N3,V6>d}F2LA s2c(\&oT DρBq9\ E@^pN\S1op$0ASdNy 0v\ ĐUʘ*D9ATbk@ZL)Ez{1N`1Li^Q/V2+G#" PMiLkۂ VK349>`O㌓$`8M83.q5'għ8`^5\`P ][)Jӎی`Ց֤d~c5$9A(1L9S%!(4x `φ1!AjtNe+^U'o, pH3)`gcic9c 1`L`` h)Z^q LA) `6 N1QJr#݌J1L W`11Lk0A Ab 5   0c<10A*=Ju 98~fD1   b3 p`ưA`0A A`0A A`dL`  0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0` 0`   0`   0`i 0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`  (1Zfp``mAc1 WeX0ZrS|?ov|A=tAc10A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A Pc&bO\aa4x ֞4ϗ> s0wk!3(O6 kRxg&dot 0`   el>e1!j?,bPpJ[q+DEθ c$W.VU No`|~x$ ή0bY~#OfT3 &`0F 0`   0`   0`   1 cCS¼ۗqRG | Iˎg=YpXJ9jy P}h`kOi҇A`|DNtЌ` #`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`^~BF>0Ps$0`f cpdG!\'1AJgb3a(1B@I PT/W#&1 ǎ(I<+7XZ(#:ּHaA2rXWeֆ}( b9#ZMh͝vFYU@K|Ġ|(bGp1!,XҴ\1̊qL#bÙ5e)Qc g=Z19AT9~0Lg|N*c@fc0c"O^fM~&$|c1U'L&1f05 VGqb,GZqq31m+^?qd`ʹVVٍO0S"|4ƤP NTyS^\ I 53Sጚ#bPkR 0`< fG44~ A Ƽx0H T8Ƥ΂1LA2V^^xF% YJ믷ccACe\n`AhA^%#0{}?°AL陧۞3%JPJ`%I9e*`=PAx0A3AcX 1\NY 7Ayy'pA   cH 0`   0`   0` 0cA`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A+^<380yc1=`8dV X +φBق yAc1)?0`A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A AbT6Hoۍ~ӀFW-cH0`   0`   A#$a.5̚xg k.pA*2Jc P"IchJ   0~g0`A`0A A`0A A`0A Ac"ֿf50f4?o5acS?l/ƻ+}ώ1A9d~1O-93X*Ϻ XVxc"4^_hTN_n3A)ΣcF1Lf1 0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`  }8a)t1314}F7+_}?pb~y.$rgـ LAP"e`DXĸg24r<+dG7X1}5HSۍJ)VW:Te^x`̮0Hc.ZgTiCp8:`*P C*c͆ 3{Y b$>`H6kH0iƴ>bQ1zҕʄr‰1h$q~xs&H )} Ag՞DS f PxW,(>b0HW:52XdcH0cr<3.8L9Fpb9{j>ܽ#0b**8 c1ʼs,W362cQ(~ *-0`ȁL@F G,3(1Li 1P81ڹþ1Lk9 f10A Ae0AcX 1yn pˎI+ *`F(KotBp`0A A`0A A`b 2)1 A`0A A`0A ' (HA`A`0A Ab. BӕqMH4b麟,R.Pbj+> Os><0Vqɖ~c,>k6 bhH)1 c A`0A A`0A A`0A+20A A`0A A`0A A`0A A`0A A`0A A`0A A`0A?1)<ơu S!0¾H$ֳ0i>_M0f)5jA(j8)G gk3b \3J70N+{q4bk~1)tA2rm>bH8F ,J`>f\y1Pː *'4jje-Z m.^fo|j1f~>qƇ>hL('# k_h1^Ԝ|O#c|5`Nya(R gTIUፀ߄jN`k>Y)AP1oQTQkAߝhN0fS Ԡμ i/>5Ƴ#0`Q|iώcMpc%h"uV\Z81118 ~/~bV ys5A.Dd|1-~+O<8Ucx`xA)bԮZP*cZWb1p901Íg1J(H %X A"OÆ6GĊi1JPd35 ¢g W9gƜmA.& yW!gtȊg\ PֹWu R ` <x9? V ~#.t1 4 1 WLJAA11Lk12  11`10Ag0A+`%J)``10A A`L`0A AyrA3 0 ` 0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   G?v2M cA Sp`b: 0A*Ab   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   A@(Fg"Dc}`}'t~cZ1 x(1_on! 0`   0`   0`  'e2hl~c0a9W3#2;)1 Ab$Sl ]<?i3M TM\2`(1FQ2 kqic7 0`   .wSیFc1AW Fsb9jTTm!\r<2?57R )*SeXX,v=q+34 R8ƪHȃvu00c)2exc}iE9g_Q9yxa31PASOh5`f8 a$E~#x0 a @W' `uʚj}4 yOR||r,+N8„0c"Q0` 1 0` ``5 A   0` T =' v!篁Ҥpj >QG%85wcUT  bj9tʼ k0' 0A29',֐a1X <ϲg!Mj#0bӗdsS ŘN3*qF 1f  qA1モ1L `0cA`10A dL A AΰA`H1Lk'1 0` Ȟ * 10A+ 0cH qAcH 0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0` T~')1 Af #bw?#;mA`A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A` ӝy `FL`r'^8("r׍1BS`AR#WT'! A`0A A`0A A’h(k5'|(r5O,ǜ-Nb [|BRjx?f&v*2X &1O`Ќ0`s5La) `@ue\ !Jt9SjR7Ai0+.Yc3RJ WM#>\mH1@ xp?/2_ǎ50fD 9c1) ¾ģ!U^7N S`0`   0`   L1vJ&0*YAc1/~11eWDE8`&R }ԘQ)(g*j8x`c,4, ca8EA24ſ1Ӝ0A A`0A A`0A A`0A A`0A A`0A A`0A AO>8|Ap}b>1εr#˅)m2L,e( PeƸ4N $f+O JrAdǼp8(g:AQǏ"8`b \lƴ&b1\+5f P~X&D0bN\)^Ƶrxxz0fG۞2@3 Y}a(ߦ X"F^#0xyAYPZp\byr< RV b\3@ƙ c9: `*t/}r#,b(H$}1P24>)0Aq!Q1\m0Jq4 Pӈ>jBe13 A``A3ʜnPb5?-A@Ցˑ̫ьc dAAk!Xĉ1S*e8e3)\?1Tbf {?f1Li`Ƣ3)+`28$1L0`   0`   p29}lH2}\hL8 V'ʤA= T3"i(H{Ť{s 4Rg]brdƊA)&/y'F*Bbeg e1`^98P80[ƒV )ԾS Vi Ll1v bf6Ӻ PWy|x Fx{ʾ5!I' Pێ 5)1/fq@ [˜pA819q$*JRi Prxƪn.| Ŵq'.1L0` _5{~k'~h1o? mo 0F o2*V쳡ٌ8Hk1]>}'Z`)}'gn1B(H48}aI)ư`0A p` \ԊV*i0-iF38&{{urʔ(>b 5IH/0Fe#1 & Îx "xЈ1uǝx~ Hol>/Χٌa22pԃchO0F 0`   0`   0`   0`   0`   0`   0` &!STD}b^TkUAV``1.)Z9:#3.qq5y8Č`"9c2Mi3$q 4yW63L@ 49sԮHF1i̲3ƄH2 BFyapLcI [O嗷p.\b R\03CZyTg,jiZd3]ј1 QN 5y|=o (ÎQj4G@/vpoAYdo﹟`/ _6 xe`x{H> Pq5h33Cc981q|BrRd8qb֩:2AFٌ#"` W\)GS0A+^O l%{w@lrį*Tjn4j8i #0`M495&1y*TӁSLm0pALō~ЮA1#`jNg#>fZf| c)$c1p^:ZA:ˠ3:Wi('X1AO7<,01jW\5I9xg3kCBsx1Lm?X cc/hQ̚W͍cPcU@#0bLE*iፁ2b S 4*㌑8 @<}a RD< r“ \s $M cbrE3G>CیH Ÿb3)` qA0c813+` 3)L` 60A A `i1 A AA  b̎4{K0p0H` 3"L`WA ``ՔbA   0`  `0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A Ab8l S`pFi.s5+ Rq%pb}! q0A A`0A A`0A Abң݌4(1ic3Hc`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`ȃ0F 0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`1Z}g)1j>lLӜ[St*>% pb˘`10xm9 A`0A A`0A A`XZO 1&jrHo1GWj+8ErNaRSSA@-I{12ҒLm!¼݌)8ʒ 7y`7RDbL`|P{!# TW5*H N= ᗿ*yXI"`< ĊQB߻0gT 4 ro1G\lΙcgt/`#UL Sk1D^2i ;,60bߋN3k,10υ=a i(1N^Â1P:`}>ʌuFÈT19FsD8?~29ƫ$81Og`Fx .P93<#t$~!81sq Spfqs)Q$ S?Ƅ1R8W)>0cya"cX0` ]֙ N. |=$FB(1~)13=b~G㌎mWSc̞ T `D'8p5¢UbÞyǏl) (毶 [Ʀ  T݂ Sĥ0A A`0A A`0A A`0A A`0A A`0A Ac|p̘F>0~1 s3)^"^Gٍx6ш0`btiZ`U2SZȟ ,jUPA4`=* xJ8ƃPƄR@Ʃ FMmG: XԘ1F*1F #0b)5#%C'3 h^4(kLTeƼic0b4 U IA)JgX ,'*N3 b0` W iTưA0`1ox00yj*U|T<Aْh(@*yc0J A\tH+,A9*`b#٨V??A(Hkuc[0b20o [ AN_f2e0'*Jeov3c0^!8f X-V hgCcZPNu iJpN eJ0x *I r80bSΣQxL1,ADT$ѧ£0Ht`πEE)Zݵ F`I,`uГ%)8g Z SSJ\#<Ÿ8 @@΄pb3Tȏi? f|ŘӦ3.i<|}O~1Jg *~e*A/S<ˆ2p [eS m0k>j~n9kL`c{+1U T B+0b` j)rƧ./p`#6kxیT 0jx9l+-9UcR'A1ZEyeX ņL|f S`H W1Lk0A g`$` q1LAA d V1L`A+AcX 0{.A\ s  ` ɦ;ưA`0A A`110cX 0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0` V}'k Sb TqFb^\)DŠ`4fqA'K| JD1A`0A A`0A A`0A A`0A Abң݌4( ZA2 10A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A` #b*1&Pb|8!B@4bL4-3(ЪTbf4 0`   0`   0` ,J$aR?~"H%3M>&9R3ٌ*A9L(wS8 H1D>eJ!d۸6o/Q NYCs! B)OmG߀(8Ì+DΐbT|y`+^ /)L99sB׳וhIχg10I3A/xbx(b(5T2 1% 3{X/rOJcS8Y9M )?n \k1OǙ>Y0` 1o`jˆ\?10JrH>^'݌cEH2٩qP}bJrc"J SیƳ ^ OW>ƤRJUL|M8I#0q N d \k3)H`ԧ7H1SJNq=ѺJs5#\F1_XCUL0'x0aH GC38ЦF`qe>A>S : [d U"{ Rc ПC3i|} ӖݐA1f ^  GW|0A@$0 ^ 1(1b T f1J:W,ne1f-<(I'HȤFU:T q [Sx~cYkFˌb PS~~0X H5<>9g2AbkwV1)tF`qD`&`:$#0`_3\c`1f '( ?X`ƳX  b`ԝi1`0A fPA`  I g1 0`  ch 1 b0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   1Z WI'd0bF18 o8$0S}x@.cr&%  fpebf   0`   0`   0`   0`   0`   1i_hPbЙc)1 A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A Abχ̌)0 xYҰPUq̣I0F 0`   0`   0`  2&IBdPѩXLʓ*nc*Bp" 064ExVQxf0&8eu+)xs/?c61yPr4cvEL6y.90dx6mGۖCVsA:+_ k)PBEgV'1Y$S.MLj卟{.~1| X1S  ZYH=猀cE-J S:X=Ѩ$on?1RTS1ϏlT M8xdg a*55 SR/ `+ {0Fe ^BB-n_qB2Q}I$x P\3Q`*Ž>`3jXޓl<8EH)2 [Ɛ`0A AO?2c`A`0A A`0A A`0A A) d A AHu+&e g_}pJpNte8  V:(c!@P1"`h<8d b80J$S/qh0b?( @?18f \y~대'X't iN=`*81eq#i0Ac1qp¹p PXHEpc>`FC@W!>J1a\i8@c f 1kaSNc<1 M?` 533 bup#h1Tm-^T R0DM!TE+Oٌ1uc ]BGÖOχj` db9S3#JSUTaX1iV&ʀ 1 aʭBA#NycA)`@Թƴ$S* 30b!T9Ϗ|H]D\d:n|bfTbh9Z`jJhBW>~ߌ]oZ /_~5f  *LM ŵCr)ZgUt\q,_&FR P4*}s#.PAgL`T5G fq| `Ō fA gC)ԥ}k̒c-59rƥ$32eǍWA,HS,A9?5Y?@W1acS" 2)OQ߿`#*{I\b{bKol5gơt=TW0xaXfF [Lrʘ8)*6 _:*Zq)9T1JeX1J,@H01O)Wc}c1T`I PL(N|q %1n3 `0A AdV ^8cS $HAh(G\jDd+*r1y>k J cbuTWV˞S*$ŢfjQ:UykB3t0)YZZk } _3]5t8,w¡TDo4'Ɠ8B1y?#?X16%]{1* nX+Q EvЇLBΙd F7$](qIz+1\c' TВ@yVXʤTJD1xB+olS<'im Zg逎1Z뢏+֟x5߳ ZMNT |΋M9g­.ASRjc41J-3FtvA}jDbj181F#'qX1pXfhIB?g3*pc>/i* k^1rևrSA>ڃO(=TƲf ^ k#\qD0qG!xQSd#;PQN~c3$T k0%"y bF[V b(Lje Yx1y( ZPgOe#YF).jdW) xH#bb   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   1p\}~X*L0b p 6RBО\?1Da-6Ƀ 0`   @0Ld T +8L1u8L~bH1B`0A A' 6J Aʿcn̜6g*c50c*οƤl1 '" eq"i()?8Ф"k,t፹R3/џ yUƛss~dI )OhqN>'l.Y>Yp n Ƴ+唙U1FY ^{ qLaUӿX!IO1COfT54T‡5$J Lʆx ݷ\s>9 qlkΕt,`aU=Ag?~3L#_*}{s8TO|O< `̯1w-9W<JF Z<ēÞ2iH'9*0c.Ur?yƙ *b~#:~8K7BY=G>u"Q/lV}vA#儡bG"|G|>fjI XyǷt7}bԍckSxeEXƍ2D2cXZ a27er8S"CSsnpV;m81G]kǧ_cnܼn,H0Zce.r;"տT¡÷F059SF.t#!q&@+8j-jAL}c3}R Na-"4) 1b ` (!K" [p`0A A`0A A`0A A`0A AG*kQ N CAYZJm*A^431!9g P֙forưb4!Xۢ3H1Ja|0H `T$(Xa2#23,ɬA 0`POqiV1kS*ycE#" [: W0+cDfSLcȈ1`>w_ys&Q ZM }ca,e?0XAP+PXssL-Vpbd閯HOA.?1.j0#xg5eSV921  As':݌eX1aʹxcX W N w7R c£Pώ5H֭E pbQ]5s1QS/q 1nYh)|cx81n~m^ )LC AcX xXr;{ưA 0#/Dc|C^5eǙhEc(LxS N ^P aTq˜m.#LAK(W<+QcG H1 3,l+8ׄ"$ԁ@rʹ1g \ h2Ӊ28@`>EGh24p@03iU {)<`Tq`4「H߱?TLMTAϟ<1H1^ys0c"bסl@R4R4sƔ#/e/3@Cg$=#0bڊk@6&c0Aʆˀ`QTNGƙ e81P>1Ng[1Ki`XC͍` _PAJOocA**µ<(1nAB8d0A*Cg\T >fxF`0A+ʔq 1Rx?+9O3r eo8AR$Jb _nR Y80`  kIqʨxkJ,hU*X1yQAOf5 $bVӈ3gn[Dɖ"x RCǁ0GaBJˍIQ$L=e(JIu 1aKt|Fbs~a)\ sqO(jN QTRxfM1eH 91)+UN>k19o0!Ed)B1/cuF҃wgiFŷf0bBe# w1 šHc@caA=q?0gV1LRT#žSx+%=bvE#۲ bsCq p˟:ay6O{c%rϊ1S@ۂ%)ARyr Ƥ&du B:ԏ3805G@1q imbx|h>OtmG0LL?~Xm˾ m>'k.r?C$xAJLqB$ rϏY@Sb@)_}o)j FTc OIPcpg-9LiFT? љIrMI.炘FTʥ?qSa.Bn1J T 8I@$YR[ͼ^1@R9P`0fGJ[ ,bUIa21( 81=9t_O2G’ܻa@< .L\adO1Lf0q`1B9A*QI31'* ŏ"C,|qRe1 :a~Zl`᪀fW5 1ZF0w b,8ScfȜiQo̟Á#0a1J\-+R5RUA9rݍNkTTPC%3:m10A A`0A A`0A A`0A.kA'$AyN'5&Cc;qiig))!5ه(!#)G+O)pN !ƾ l* L0A-Z-}Fm $(`V5 @Ča@H@`(1JA("1g1H0xq}0 +T,f@ r~ܰ 2ocqpbZ45:5WSU) URp" YӜm \ʞ8/8cH1eNu'Aj0Aʔu 9q8gwA \ +Sb@eq\8c3J cjn ` ^YS\brt- 'ƙ fpbhq3݌#-ACeGb d0ҜK 0bJkS|3X&4?xF%30s۫50A2jgSN_3n2AR3"+㍓0`91SV1q+9 S}g1b5Lj4aX1h ` & 1q5. 9Њqob\Ga MAjPq`Ncx1pc檟?J#|%(3E.32T%2SF33̤p5:Sr be8WHȬ559:)A*ԄZS1ji3/hA9S>5ƥY0 ŭ^x`c-:Gh>Xҟ IeqT+,z4"e20BAStq b|+>\m1vu0Ι8Y̏19A}ԜF58A81AAɼ0s\-y҃ T{3$gH 1F0k}Ac\#0`X q`Ӟ6Ap$NFF`0F }8F``cb3+`4A8)Lf 0`  2 bs0`jA)N10c&0cX `D`h   b /}O,`Lcbt 0`   0`0ch ~ s S A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0FDb&Jbk.520b9dsc1 `bb3Pb|N `'e W(0`   0`   0`   nLi A`0N '+60A A`0A A`0A+pFf%)1 A`0A A`0A)LfqO1L0@` 1 A`0A(1a_ l $obf4 TP#l$qq*p"Pbb   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   ~f0Lnm FYpƦpa$,%/~b cgϙЉ5bbT1R?y KnAg d`Oڟ`EJRBk0 h(08 3xyQTSmx=ƲH*TO1ٕ?of7۪ Z>S3&2ֹ<2qX)*@J[1BPbrʿm|}OIbHSC {0\jԑ Pu:+&0IO{LA>_6kJ?,2$AtFHh S.# 3.`ŬH:||xa7 Zr9W2iO'/1R Y81g?0+ 18Wj'1xNU8$rn1y̼0VQ<0bX)IV T$p8}1 Sx1(1_`ż}:i9>1g:N3TӃϸ0`A4s&`A*L)$0br/ڣ1LWEG*$YPOO^20b̤)?)9Pdic;ł}anc(0`A0` S cd|]OTG/g/.\yc&hM$ԓQFq" m!K9S,XoJn0!Zq#< $BW]0hJ>54A'ϻcC˨~f54$FEk,r!iOch1i]U ֹxcO 220MgʕhjH'NO81~JVUh [b/9t G"+߃}0`+Ĉ93R5χ 7f|t9Omx[aŵ&i§cPI AǏf1# \+#7R4r8Nt 0`    L`i%)1 Aff V0`f`#`$`p#1J  ̠0`   s1[Ÿi Ag6lk Ad p@`0F 0`  fpb#`0A A`0A A R7Fpb P0`A`0A Ab5) XA3Hje6 JZ0q̜=qư`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A AbOpyF j&D}ـM1P8f )BR{tQ_qMDƛLm!}߷ hq fnҧˎ>QrY>gL=q YΜЍ'-ݽ0``Oa&9 V΢:(kV5B3^1f6`+L9 "b+)P)i4y1)eHAVٌ ƈJ(IƤ`9dA1"G*T?8$cDɃxێ24c< sᗿnMAþ Xr,Zj|'*j矀`FVA\2I<>߾ >9qMO5 LJlE8Vf i:pN\`kΙ8fc ZM|H `FVIR`Ciʘ(c-'˅>c1 *xe9{y))Ç'5h hxFpbhu+Ln@| jeR hX̣@1iSeJc#h >1@5g/0`+:1xJ <3>PbhiO6Ck,e*\n #C@35'=\0ܩJKXIPt*#_:O*Z1͵{τ310A)_c1e Xup)22ZwF|>0c y\ hxgJi@6Pb?)$49)ULV bi]&5ɾ*>,nN;|!ܥ#d0焧2}qƅ&yat:ߚ{ '.h~*q]{w_tJG8XDrŒ->!/猤MeՃXV(1L0`   0` To`FT$e^1P?xq8 ۄ.<3QC_w ]|?!O,[oh2Ƴ c/T- jT0m)$}߰c]bҞ1I Y`8np|m2Ij#4=<\hx}8`ŤcRNS N Z35#td1hk>Yf covT˞x ʃxS#S-trcASyAp32e9_if1/xxF C.\?E1& 4QR}#,6F1P+Ɣ>(LH$R-d+O~5|,4r'`?8@FuOƠ'0P>r)S;g9 2O)JS,Cwmiہ1Μ`=8d`šQ4op'e c<^fx Cꍠuj$' 9AJ}s1)AX*O,,j1S?ox-'Eš·`4Aۍ1j)S.)>qA!6#/.oS2O Ln-$*87V \9TʚsDZjq1-Ƅ*i\Oocn YxJ)FRbp痷 x6Q5+1ЃJqƕ  S tf ,gu=AcA2``Î b S1\dF 0`A FDciʔ~?g oL7 1 JA)#0`0A AAƒ=0`&pA  6J0c2`  0c4 W#50` 7A A`0A A`68J0c$o SA A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A-`…P59p3=BR <*S r U!KҞZV |0Pr#1aI2:B5hTau9l岙O=-?iBa.XAIZ?V /|am('8_L- \@A]pbڂ?hl?n3"03%@w=pb59W"Eq5B  bMi\g TЏĞt?vȉmA8ȃQ\~f$="Kq3Bc1x1jT?f5(R& PWRI#)q€J S_f (xg( *TΜ2|q6 )CRkZ0ҧR!G6i(ubPPPkQǗ<0a),dIƼ }ژJk*Uυhxb|h?cιb7o&M?? q{LbE8+ vNK쳃ጉBj^c>_6 #.? x{H)UwL8:RIJR dGgB+&7BZ0ۜ&O*3#۹Hˢ d6y5%yMqèkFIx#o8öϭRǔ e>ko.,n_lq'\'ZܙjXKm Wo(ʭM@c &hp~ŊBܲMF6J~Է̮3cSÖn6઻A|39 (ڼJ1:nR&OphN#h1Lz}/ a<Q&^ XYA WƾfxGv.pccxmS-v #c Nqa GA`A`0A AKqef@ATqOoq&J1n.5ۗ?`Jp`:cDt91/PYkq cIAXs'cPF䕜ʃˇ19F jɚT ] >ٌ&yk <朻mJ3fcr?0(pZqu(*O8%!RvcyA1CJ/xF\;1XœOHA5` ?J62p Ö +1Yf 8̥P0V\xq30b>j%RxF Beʵ(8Dg5Ƥʦ0` PӁ wD  :wqs  ʰAkZ sScMܠ3-\{ V (OWc#1a 3c0c22f ^3?pF xIU2  ` k=A>jĊ `@1\ 3$W݌s7 C) f24<˜/7<' f]Eu9V8 Gƫ@PLp;j;0 Y!q PxqxХc u o5u6  ~rWS,'ʃL' I djNp„9Gji88ƙgk(1i NY5 i80r9qe`8W:MR1n1f SȘ ]9W_? x O|0A'O?O yㄏ `ưAO\l'`xA f1ݍe3X1b ָ``MS%Are%0cAbЈ1 0` W F qc0`bA`<   b0`  30 0A Ȃ  `  0`  33)A dA `VA   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   1p5{~ÌQH0%ozG4+)X mKǨz,h YNtiƇ1PUSXMl-'AIp81L/pc;o(Ei@J fJI%ЃBMT‚%UP.1i>'O6?^8bMKSc1eR p)q=?/׎Bcd|$Y9qAd9Fl 0R6q5v1TC7pHC-8jD1+Xb#X0`Ґb8,1Axc11\b6Ąl&*7AU90c1`J' S,`3+X#``tqrbrc1t0A4b\8)~[Ty8(P`&N1^j&E dxD%5²+n `A>1!X1t򦿷Uc m81p59Ɵ,#t M'+($? W*}c#(O\9~ZoΓdy׉EK߱,r!9c!9D:]YY1~Ӎ8a Մ $0JP (( _˞T9!]?t>́xm"1߱=jROn1k ^ygፁ-4)*GV£6REe81USEOt`B 2(PtU||2Ƅ&Æ҄#L D?H=6"`lhƟ2ag*(NZx`BNi}#0`g$-f 51MkJLnEy V2av$'Y^FN|Pĕ=T.4R(ӷ|Hұ+Z@ AZFn' o8[s5_v 0]Y SQd#bګ %(y1Xk!nWv)d -4F24_v< f7GyƳ1-_[*'+\) & #`0A AbWdh …J+05nI#1Ud)\ &ʛ饊+y)Tk"j0byswm 8ye5' D 2Y*8$&8p%s/H1zB[^ S/ QE/ۯ.9CJg36}~Z1Ez~d J{)KʙݶaMPhk˚||+F0AUvۤA)Ti"+-5hT)FR &~X1(1E!j~AN A<<1G1?c q(׉A0_2ä嶕# eP '1h3.^n)HxAoٴ RCAZq L`6vvur=Вrëmbuj#:jЂ*xlxIG A*rY(^X@o/ ^ +rlx`T!r)Uc'x50b0ʜ 3x1O5H,@eZrb( Z U&&1Q81ZS VҜA,m 'ˉ>Gcdv09W~<1AO! b̠Ʋ `9A A`˙ʘ pAc0cA`wA b0`  2`11 A+A AcR#0`  0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   Oۆ̌=vx9F*8&c`(pH* WS [ƳLNjRgAx(e>9T0᫗ ND>1 irJe${x5;\Sh`k4J4laÏ:c(y 9Ahc[>է3g$1eHc2Gr>#]V ּpD>1#~n0| (H*H"xS.MJYdڰbFMQ\8bXL54ݿ0_eLn$) G7 XQHja61<ź ƥ,Z?v60DN SbDAb db T{#a,e @'+F` U*ob8‰Nq4cw|ŤH 9Cc*Ʊ240bb ]8#pQ2Sbs0 c&$U U +ߖ2(ʁ*<@r5g [pbA1!mFW:eYc10A*8dc/` 0` W0b3Θl*`(|݂F1#)1 A`0A.S PqӖ\1)#1LA`0A AW#c2F'/\pV'¸Q Ll72z݁BBv*ƱA`A`ā38Č0F')0`0`A`0A gtbeԉ1ig8Ѓr10A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A AbDL,m⦂8jaTHۄ`埻1U$ ?qưm80` fT!ZfS2) O6Ғ7oE}byr8fr?uq N S*fχ۝0o2um. $ &[m(J3Lg8\ե:^U ιq9LaȸG)3:cTy)L֣Ì"/ N ZP8 D8`e(1BO:}?2Ռ)G|}b|M'71Lwc1 }0pˆɦ0`U4ξ"iKAW!`m3?qci30c!aL۾u$1^1hQ"*rI8FBGpbˇ߂xEhei4@ eXB q Ӻ!J? XiLWDXMYrx5@}ㇾژBD*ys G`A`_naR,g+*A9K)u@%&s% ?ٍjV& S`0`   1d+N8ԤY)bc'/ۖ1jq3T(Ik*$I'tQTk S`0`   0` (H3ʹa%+>iN 8[уVʜOpقMYeZTƽ g1Rqxل3Lh(PǷ!3,j-H L+.ˀ9x bqI28OOv`N~8@(7 JkO}LBTf`xx8qc,Qj9B(H.#)Vxb4pč1w}c%<`Z嗏 ed((m#BAF [c0b5e, I&Iol(t#u'25)݄i!Iʀ)RIH Ţ2'2#YArTrq@3Tf ʂ@F\$&\ #\(SDjPn c b \r$$(3&|`x q"3C*2_,d$`I3'y^10cS81 0Db*<q2$pV Ng,ds01\\`JsnA '(0b9p55s!1g Vr%82 nn 夑Q^xɖFG1_?'bƩG5*g#1+^g.#Nd92 'A ¸ԪG $$,Ǩh4 i2pYQn#?1Ҿ9FLc@-c\5C<#8~Սsm%1vK ϟ<#qO lT7F.h3?4R8F\``jxpUS3 ]F`< YSʹҴA QWJ0o#Ps)O4k.cj-j2<9]20S_nU#+`ŲZp oc %LDDWAu.GF3)LA(M> IE) IfZt*h`1QQǞTsdF1(i̭HG8ABԐGUL%.G y[* fBT1(#bET p_ `@;m(0PjNC@(C)#2  N J@ tRsTxӎ6w@ $0,)M<Xn & L&v0HƔ`YS<e(1=щr_mp2<r SƄ2U: APh9MM8clg-Ѩtfx4OectTQטP1SCݍ`DX7\jh rL$2\ *BIZBiLvon1@ T3{1d$DTf [3.;9+ /0!F< `'T nA:KWbԣb?U1쇍$\!*$IGȑz'H#) Hξ>n`ۼӀ"?w81fE=~m`ȉAq V Sc.sΟ݃tc1Lb5og`F 0A(1Q/?v&Tx`A|uS^Y 덄P {~ʱ)S1Au#;d:H$SS4Iu|Gvf lЋ!I |0``0A A`bc10FfL0F 0` 1Ccuʴq/OWAq( e Ŕ1i)0`A`0A+1L0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   1PhkRdg2ϗrAa˞~i(_5&q^c2LՄ&`H_5_ 61eZx֞JHf1 XXٍBJZAő4HuƧPfjlg2mC)- 759yT7 Aǔ5)m Ztt&=Ȝ&d`If<v@3 ,6,qЎad1A~ܱ dJH40rbF[¦dWcpp%٤ȣm3ɾǙ2,h gphmBZlL DZ\33#ܖfexAϯI*j9gNW&S;t9mƓpcJj4_7DfM_qÅ<?i;vw^= <)݌*SyvPc!D J| 7H+Q7}2v0!:e΃ĊJ+o(.mYAR`0A A`0A A`0A A`0A AbZ}v5Q*y ,@Hm9{),hN992|(9d TpǗ@)}s1~/ ^rN5/~5, Fbֵ<4b'QCŝW`ťMy)j&dIn#P$rƻY ACs0 10bj9|G.@?|`Uu By=F :q#4cc*|b c<hISO8 ^ C4 eE8pL񢱌1y>~0qgu`1@ّh\xib`0~sHca.lg{pNA%6GL_Thx`tdO|Q&lw@I2I̐.X V~a̚~c\0g)9MN^4v20Ie) ZW*f+U B*NUe A*uJҚ@#X0 k A ΎDS??0(eMDʜj2L/55*iO n6D9(L{w4J XnD dY߀FS0%,355Mhs2/>4Vp2 , txW@& RqS$ g˗pH1W:bA!B)950c&ƞ9{F1*1/qEFDxg@V1X1CVo+dg-ј0qvZ~`PLAM3E|0(e`@WKNG1q,voVpc Ç/(4 10c/oL`A gb&?f6A|pc$pƹc`Ӷ0c$   %H pLS 2I8ـA*M `pg0J gX _r Ƴ5 WJ0`b f ɔb 03)L tA AiA)` 0c# 0cA1 0`   b1)f `0A A`0A A`0A A`0A A`D`  0`   0`   0`   0`   0`   1Zbb6 QpN6+c1BD0`   0` eSVNgq9m^NAtKyt+fp1%*9fdi#.XO1q<`[D0> 71;`BS/)QSRXPTSVZȁyN;t Z14. E&_:cWNvG ÛWZqlPx&rS m(@H\A98Wㄊ8.cX2c ۸ITM,GudB\j8m>V.Epki6Lۦ5%AAڧBH ʇ)9 X.UE|3>z}Ų& $M*BGF4xf e!, U&0<|AO ~ lH'!!02|ņچ•>c`)omRӜ 9j}G 'Pi ,rVIP1} +pc9A쌣1' 3[+lx8aR#"9F(Pd<WLy P5G||yc'vtĨOSm x0`߻ 0` ], Ÿ#X1w5Ag# Sb WxH1L0`   0`   pA T =1Yt8ST0Fb 0`N (1L1ur9NxR^9{1z`I:Ucg.j@_͸R bF24Dk˻adZS6OΔOiq(G.<}ư|?g/wU1>k,NTv6#&1w>yr1?5xpT8T¼poSOyϻc#L1BA1ʄ1RdgX1e LD%AQֹcaS(MD9v0`̟>1I0b΄Å^8* L;hPÏVsɓ+G q8̸Ш~$12VseUsی4W='3HB0b΁f3 MoO*ҟƼid'8_s&A3Pc$Y)S jIlܹ4PbUYM@\edHJ fuAo.rAT4-c34AƵ1)4:Z^TRA^?d@+ 0G˖ (c ɨ< *<qn1_F #B~M O<Hx۞<2? hklRe?9֔>G<16P'c}bKRJdnb5@*R"X`~q49QS=щݰbq^%*)(1_kiBixB| ʑ5)#0FU^dc+9U shhrJ54)ǑSK)qYsm S3Rs'8(J2IR5& ^sͪ X*jw1hs~iKҕ*tA=~0 >lm XU?(Ot$XZh.0gOeyƟ~2~^0q5)Z nܦge` "214 W?6 Š4J%UFI(6ygo1#ia3CH°bAtc"PbǥZ\`wDW|9jA0$L | ]Q 8{ m"SZ"ϯ`9 SJ_)HN'P@ 1b39 A4 g`XF81PA>'P Zp`e(iBTHUwJ TL)G? bȀH'ƨ* V{g 3SSx $Lc IͿcqpc( jxUc2$J 1peW1`KԌa= c:W17`ߛo8b SHJ͐{y '52tf)Χ:$Hc9A80)rOx{01A <뀨tC.t& 8ƙsƱ1j5#!igk jFdyq#ӉZ>9L8& P MLpFS*b*@Rڜqd0U)N#3^%*F2L+B!\Gy"Ff G s@1f' QYh?i5&i|oیHt&Cm(ȓQpܫv UtQK fbI 9s,hh0H++B2+@ >X$ 0NbPV99Q8 55p,@ri= I9y瀘 Ek:`b}A1 a`3#R0AerR0`<`_m?b/0 NxA)^>bdF```L0ApZ|Bnx%LbA  A VOJ( 0JPA  ct rF c0b `ưAf0`6&1)#0`0A dT gt`ưA A A`112yA f1Li 0`   0`   0`   0`   0`   0`   0`   0`   0`  8A8l.8#13A0A A`0A A`0A+3>bF" .kP@G 7X 3۶%ԧsb)Ia.r[CB@!O㗳La*P vo"@HAe>b*Iξ '9$ N3Og#X(P>/2SM>7|6p6WsK"eJ2Q_m5ϏM8t~ =nR\rS˟"'Le12 kICmYd`¨ ypIS"YZa]x( #a%b=mXv9ˎsCN{Yo0c i6FmB!~EʳʰbJZ>b5chn" ~L`a9dː^h٩ٷGQ2/3΄Rkj B!r3Px+2C)_ӑ:1'*܎4Z'Iakk<1JIw1tI0*0 8hdfdE=pFcX0`   1J`jD3P`0A+ m3#V‘Uv#QR ZfZʖLqHY~RUJg+ `c I$,jD$ 10A)J1 [Jf1ƙH3b墩oP\c[t?yJ cЄ0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A"?"7Jx14U,`EsOjRwBy?IA$Uxڃ͝38jR<"y <]0b%dӞ^I2$S8I¦'On3b%i@8~uE҃.IߌHK&ツ(0 <9{9 I)~*ye>?<Ӂs51ѣ .0bߌuUO]֥֙2ФJ'eΟfM7`M+:PF *rT8 # TOc sΧ*Dύ1ѬQlSLk<0J9|5M8A@ʴ9vxDRp`{oʀ@p $$An0b4ʔp9b2g[DEO?aA 3* [1Ƽ:sc2hsJڐbS qc )BO3BI4*\q *);AC ad4nb q? Nq2ݰ`9eƔ{`c'Ē1ڐaGA<}Fx{>cSIQ ܐ@ Lo3ψ9a"2>B)+ê: Ͽ I|{rs +QSci3 OZ˕ eO|l#tМC1@h?cq*sPbPד3=ѱI7K`یFjpۜʜ?j!M)( rx@_n @H8ÔW,{qL *U"UNC4 | 耾GٝGD&ii%-tߎaX 920Ljr=Ȋc81F!M~o2&5\l)25.5-Oe~,ZsuMKˍvu|tˁjSQt݁k>j.'vo cjh)a.yݱ8qc`0A A`0A A`0A3*i}+  0=Tf+#Nyxk0ba!@TF4*KAzW m%F> 4. 3 , ]Q><0pDvm4ImNS |L?Ӣ dҫۍfML-塿 v0b}&0%pb b6g,׆ĸ~# A>b6fxsۮ n|I_0+Ӷԃ>\J6D*=6T5)K9s')LˇHbqOō>1AJ y"8]<-xWB}bjScb(FѣU|1$4EL3Zӟ} djup\1$Sߌ S\CDj0bLj`<|8Ҝ 8A04Xf {3φ^82 9 b/fM~a V9shyUrߍAL9Q*hJDm-&8BaK~\ Xƃ=Tٍ}0Di1S3f<=Ɓ10b*=.UaRW*k9w1@|'!\csb1δ9e1K11O:Gdg4//g/|g EGLQ:c\)5䤎"R΀c3;^\$3A(s9ֹM)Ƈ0 *sR e@L8cpdp$7j;ÉXxNRhLa'Tq!fP2"dSM" AT,jH 4-6e0M)A Ti.J iR "ec(SIVbB*''-`q0aԓ?òLDF{b b*11JLDdK|Ji% 1)3ˇaI8K ^U+L Bp8АIL~l*PRX0PըVF!jbY u ҊH)+p34-6|JJ596]ĘiyFy$v0)(0>ANQ]q張:ZH0pbN*ͤxWhJݛI2PIbj׏xMsM|7+a.R:A\W5zUpis*Ǐ@ݴВ V~ =Q`KlmFIY)UA-aF(D0>`<0A+rیn| h]FYt4儖FcIov8iAT)sų7Q($C@QU~H'2y~Fp-fso>сdǏ1&JE%NSKg|0bp(d^ҢÔ 2hHs[XVS b(n\<1q%ݰt<×HψV R`ΰb0A A`0A AcI lcaQ#,Ʊ0A A`0A AF1+-#X0`  B gc0A A`Roc4X1J#p9}tfa+CϘde]۾3))SM/l>euƢ$x PRsjj(2) TONtLqV}AO x1 *M`<52Mk80#>Fs"~H۠4PZ{s5"DHP`9{+^1O*}x$g Z+CHjVUoxg 8Y<1` }xqp@\:1ejH׈61(j I2lG VԂ kJZd/V3+QLCN3=@#-i-Căχ㌙n7`S^^q)* Pכ2G. 'g\hΘp,O|ߟ=/#<+NTVe2i8jxN ݘ*I2GI+C#,c,CA*hœ+NYg\fR!HTe.K*p'#T:KGtAlHXI)2AtRS2igv6ȏ28fyOxv(1J ~fqHf [p돿1֣p"ѢAc_ n +ʺF6)%1l2PH96tfxm„i5A Q\%$9dkœ"c(RMƙ}ƊdHrӇ[4 5RFu'1j.[ۢb_6!S1Dc8JYVXp3&%[7i>ܯ T(H JkƣV7 {P) #43h1QI9nu1'raZjNv`Ť'UUώ5 )&Rohr߻bMt˕+_~"D,oxG qGqLJ <}1JPY IkOm+c*)?,-a4*3)cYb haNS }"3+ 1-ӝAbDfxA(s~XȞ"AJrUۢ ^e c`@ELmATL&E"9m% A|G: "kUcLɍcY 9y5<㌟p 0bPxC¼}֤F Xi͉-iƹ$&`< Jʾ *EO(`0bO>rWF1*N ZG3Sh(8Pe)tgiͩ\&Gž0xAW# \dLyNb2>Tc1P6o5ŴhyR`^U}yƪ ^U)AZS:SF0`QƤOm%c-`G#Zւd+\j1"\q:r\urbx9AY a-\#j*8V{m %3iA,^|1Ђ reA,S'>U5ʔ8c# FwP-ƾc D£*sctQE A\0s9xat1\rj&1$H0H<rfcE$)1i@ Ӊ<>c,&IJь5g¹_\#) @ A i^`xх6+80iʴ݌J6SIQ_t^bW{#p6m t@րn_࡞v|:4r3();R ST΀j<1؁k)Hbunx09ADӏ "}00Vpbq}̸F`3N50T¹cƴ ɖ 1(`p0` .林9cdQWιyh48R+-T qZ $ '0BG#?f431QSr S̼xS( 1 `:xÎ5Ab3(A3f1LjpinTjg Fb5Ua #ãk-c3?`51 0H 1L'2 A* 8RSFǪ1 da#  1`@ WA)S|bqdb0A A`z 10A A`E`  0`   0`   0`   0`   0`   0` V9Iq|N6 X(b WÎX#i(Ei@a b `pF`)F0A A`0A A`0A A` L,)Fd pF`ևT{0Jqs1삾bIS_nSY ^):1)e3p9f<TTX;~w0YRsP=d Duӗ 38㴻"y9HlU Y 6IX1)Z' tpr*>aHJSو۬Ck91JdqǨ;×B+շHb8\ϝiauƼ7BiܱmXvϡTeQT6^a9F@mH'M|ѩM\,.DHVd# ja ATJe)ђ-hMjP[?Bd%m'w \#:%|<@3ldbOEG]+ ciZ C"EC'9m(Awrk+s +͘ 92OdyYYe:$a\ F^8J#);Wo#-ʃ x{ew1TDHJghˆ i) M%|eO5)&r;¥)NFcz))>akA%r鶷|ټ ?`!S<JFOY>hFT"׈@ Jwumݐ]47z&QDLhffnکUnҋ  JYg …W $`Oeс{VƿM8@y2m :R9tʑI+Al袙h̸c+͛*yA${+ @{HOi\djQIUS1 8/cRi $*c>bC 5Ƶ& [LI8byuHxc>I$Ʋv" Ɗ T8S# %#L6cq#X1u^/|SÏ㯁+vt5c2cĀ2h!LXYJWa\.hdp:Y'z+G<=rݑm ,+CV2ic`%7Z˄u\hN|c}3C(I> gВ`IؒF0bxE|1&~5gZxo ciR+9(1@ 9F%XA2r&0b3RE<ƆAݾ GJba\dITa>]҃uesyߍqU82u՜NĥEhۅ@ +R%t;fbߝ]D,Ȯ[= TI<)`1JaIC\[a|?&fk(keq4P3vND&b S`0`   0`  ̈kCIcEtG4\r K!嫅Fy)eG"b}tp 'A`waJXAb@+Zx?L cWr)3GJG♬I-(<}$a,x;m V@ZAiui&j9N- [F0cȨex{7B6i 6qp֞x 1#jJI5S/ =Kv,Nz!ZnjO}817ZST|fqCsxЂ(aVdV{qep˅f g-h˜{ d cE6ey~1xxx#&P`>?2kX1}A"~CR7)C9ۄk^)1:2!>fPb5n F)?Zyj8>Ô9N15IˁArj1MO#:Gy C\& **90b.g*:B%1%+r@+BsF2I; K )BMr?`'0302w{T4 Re)a̝R mDTVTS-29ßo5duƳIVb}c!KyiAA*ԁ㍤8q!,TqtpNyWٍ0FPSI'p#ljg}Đ 'C6oșwtj5`-r•4jc! X'N|iK}ƅ*!FPz1:݅DM|<=OÄ0(i gŠ?` +3<īƧ 11L`_?0c+ Ňk\xώ4P1J |Gr W.Y|(y\ɥ[h#J\0 DB+'><6 E(r5<|GiY.[":{pes"jFqq6[AG*bv1a2):61qVR7AM+T@3GM>5$w1F3ҿgǗU<9dn5xc?V6c/)ˑ01[ 7"B1@k-QR8eOƜh1\*ԨDi fr1+J V<FYI1i o$|Pb$fukS"b6RDCJ^bߌH"#1Q" 8OA|*g,ۣ|*g<*H'ba`1PjE0V6_|ɑPgL:Z~'*Wm\2LhTAWTjI]0`"}RS|k ^U~.'RJBY O zzW~#:|&<0)JSQ6rلH5Jg/,0LV ]AJ:t᫨=?-JJKeA`]#qßo|&R .#D(SS ŇME>@^c:}DORF(NcPy8<ÚNFgnPP=qYT>n/ƜƲON_`~j$1Vy `RII S!\3jTe OAa,`XqZei3ۜŤNPTx^< p>(0RܹPeƻ9#8*f WcPAg"g1͙m*)JgݘƁb AX<ĞjkZVTdA|?<po!bSf5`A#81 +µ]^$5ŢSVG\PPWA2m|[=XaZikv~-ӏKvr"_K5Q7hYS\zo9mip3v$L2iR',YגէNR%m_sn*`HȂQ̧^ӞwWrm]ܷ1AV.S$,X+MNv?M叨Ѿ`߻}XleN2)FTM2UlXנ\rQ)61 'L~&kVe_Kdl4tS?S a-KQ~oW,N˵',3n_L0l8iO1D;{j8>Jl{o]{/-f$![_Iި'y"#\ЋYL!vUS3gL X{ԯ%wD %(jܴVE9nJVdJU*%fٽV{ͯՍpϧNϺ"!o{w2 *a*UCq+ow915cf}K{ҭ|S-mw{\#F,uu2YDeߧɼepڭм9+&ٖ7E m3fS*R'0S%>mڻnn˭m4)+I e4,T  wVvAYY6ocvowRjmIZ.DLc9i_r^U BR˅365,LIgXeƒJYKEBgĥNE4xez6^.y.ߺr0%"/Rt+VbYQ߻Ϩ۝ɲgd nmf jTbcakq7wjCT!3 ,'Noӯ^CZZ>_r(9R%/}A C7o}G}ܻ{nE,n[6վT,*DLs#cgzܻMu]M̖!]o]xk/[w@GbNE[-Bh_g58VOIRILw~pGih@DQmejU 3P~znv!rmU?˹oeϨ1eTf"Ǧִ5=1U0єЏÀ+$)I<` QVwhw$+L)S7 AN>6ՠ4w6A:frHR<4ȜϨ^+wgw7f! }i>n~bK m11cIE!'\%RA*kZ獡 \wH!T •j0\2*Ǚ#H)p$6OAQsß/ dg2TsЮΎR g­\DoT(Q z1m-H1Re,럏 b`JTA(|Y60 dgOvxEJ$VPc>|UZa:C20`VD(p(O.\ꧏ146G.1O˟p\1I 7N \F@`:ASA_c$cǫ1zMx-kiʐo7π \׀:e_*-)3I~χ _U\aQ k\aRPYRd8lԅ}aN~9x?$ l~jpfD*(kSƸV#W[.XӜ |%^><; Y#2yqnaB>JS )9aNA2M#^A#nXU#`*`vbs 2qjYm81n3  Si=v{ Lg9 :i4!y1 ?n0b$W˞Tn')0<aS S`E* Ǎ?a Hpԃ ri1Za$(V$XuM*MS}G1|b2_+qOZi^_= "gȵsϏL'tD1Ic|΃NZ*i)0iR7q n*1IcX*.Q3N۫(A9~1mO7xsA6$Y Fx|~(+4}ԩ"=zBtG,ɠ4fBRW(1l8LX3˓{mA! *8sjpTCDU'wwJVTL/,bHQ×-7r:(1*Ԛ I:[B3}OV`\bR Ȩ?x `?<`j S+f9FpQ2 ZΧ!e(4|P'`HLa3x+*T 1 1N *r:)r䓻a8lƑj~H̀ l۱6 8`ڀeQJT|8iD*Dӈlxx`ZJiPZwa* 89 RS(c *E_Xο3$Λ2蛊\I9U82FmROݙ~8(BQ2Ѕ4,`1:Mz}z=dpR\8g%3%<:*F_51SM܇N1d6()ƑPS™R) [ _tsyּi)Rr(1oxRDA,`wo3?Ie) I2IƇ`? ~>AyF ŭ#Lg񢀑|l15?Gs|H1E50)a0il*h㍨ bP6iO,9F`1AXqd\qKNyd0|C1]J̤'n8ۋLn a%O jH8 -fLm1jh*43sPbW5PxuiҠA\`d4u^"ф *J #Ir1NHVXte4!Flxg3ra3K7f˙ &tT&ItW,lU*=[un.gyp51#p?;1Z !Tז@A4腤2E{2Vnf$0b5q'˔`O7 \ *4jS+RnDrXg u0b- h2da8VHo,1* PG#eBc3biNӃ:zZ)˝1 }C)*lC22OcU!'zqAb 4U1h ,3gʇUT`y㌥J'|c#iQ)ݎ0bk >x2 yO V9$r" a,A0šJ4Gd9c3)*A̡-'HfQ?Op<q2 S.cF ͝FCbLbW^ d,`0s x S ǖ ӂ \`)1 SR3 b1pMGxrTb SL 9 1Lk( q19A `u `0A A`L`  0`   0`   0`  31 0`   0`  &#`1]>8AoƱ YC፦!,+ۂq|L+F1\0`   0`   0`   k3>0b#`0A+L'+Fe 1Z` WMk82, 卄DnI0Py_28A z`ŤS1F0b#bُ1P4r{y  >#y X1hƑ3pA5qOA3 Sb   1_`s0b2#c%3"9dЌ @_/Qxx`kی*J|e%&$TRh~& 8nyLҡcu7 PW hyRiH@f#fm\c|(kpprgpw1Z3ʞsRpbۍcPx5n&QJe+c ɦ۠]HV5S;h.8q4p\eeFtݏ gy%̰THE#, Z˙J q8l:g;u;(Hy 5ݿvN龈vhwndScy]c7:0΂j aUbŭ%>ܿM8@ޥzYz wwf>WKo#:4˨!t5';)B,UeDR?뾅ŵd_TPטb37t2A m .4t}EVӽvkyոVon=7tFHR`)]]Uz[ۿd}ޡOu]kzyX-絭ۄ$ae-4oy.R mCD)YILLj2ۦDgAo\;yH"M" It%KL-ʡ" 9_o{rms-mv۵ Ѯ{vKJ5Qh P&ݍv{zm 靏dw7ivOf[/W6m}LwۢhG.%Bh&ӈ۫;}9,)%m*[`I,Xj۴ۮ% ʧxQ,$)@Sv~os;eܶy{w&eM,'5"+}OۿޛXhrwͿv>ڻ>û-Y=}w.o"YmkR`VG.C֖ q!+p Rq9vZ4j.6e)i%jPqH͜MڔSd2/qIil=gtw&l`tݦSlHT G=23ͿヲҞ{gO}_*w'j6wם!5GޅBǩHVlړxH m&@˙ ʴ PYW#Xr5ێ8nQP .72JU}^"~^n) ͢] + &jՍ/5 qxZ!JHs(C*"q<|RhN"9n=۴7H'U*@(Ee ܻr[hoNqk[QSX$J{eە/t{Ӻl[`Wۨ}FݯwYn륅rG,%4P8]>,@B%ai`J^=.hXJHȄ%וYRD:)o(mzڻ;.``k{;h^Lm+t6MڿV;>[.^sϴqm[E)RF%Y[ 76J~JkZJKkJ!@aLuy9C!R For YʙHQ[Տ1ݞAuqo{ᮡܮ"[y6f[dap.}A~Zr>Ko7w[kYˉ&ULG#[kpQwUʖjTKcV&'a3j*K0QZ#0ViȄJzkڗlRooȯ}^":B/pj 2JN=aWd-7N w ?S{cָ9{Op{jߞȽ7x.,CY1m}K!wڽJ 8 (JPT bIyi41{un VJTJD(*@&Ip %rٽjWcehg7m`7 TdeG$3^-G3mk}7VP]z}վZ̰ϼ]OqۘmK`EWEи=mpu–ˎ(KYW~"1FڐwOZRf[(^PTdO0$S% /Kb:Z^IFPOي55*2IHE(8F- O Q_`j)V/4m.PLRO3t@*%ۈ;A;Cp~"^jp–VYJ5RAN'=FӈUG 0 KUG<7q-k|<>R)80!ʘZڊ$F"1n5  "`(1QJ7ጉVq)1n1#g/qxO0-#&DN cq0A+OWf\`1b#bqId3fV [Fb/SR`֔1Lf `sC N00bb5ߑpFRd`0F 0`   0`  |pFS3@g }3 ).8Q-矖O$e!>w<ڕΜ:81 {vʤZcE|.gSB:y 1Jc1c4L?Ԑq&4|( O1GũZ1"IB8^uNTI:Ř% A`0A AJBpF6#1O݂Ab   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0` V,&#l->ᄌ r`G $xU Z|rpT>x64R~bk"L0F 0` fɅ+J,i9Dpc !Ƅ ^)}0H`+ᦇ>X J P{_f0 0c=UJ W+O`8NfM &\m [Z._e@ʲn|igZqWjr~8S,חfTn 湙utS ڃeH 5QB e_VFE1̄ġp(=pc8™v6)Pת ^5)LLp|1ZyO p~Fd|٨0|J)\4`c g@O1P@zQ_ۆ1c 1ZA}p@I$0`Si "8VDem,-RtW0G1Nj;{!5.drr8pG '#y)Tv۔A1ʝ>U'攺$Y+|?aa0iC`e:Ʈ j$T€HHC5,EK 8 &   nxBc jsCbsss ʸ`1.{1ԅu91PH`ń3qchHTۄ Z`a \:4\b\!@1KO, N' c0x}8Q)5un1x)(hTN0b#bj1'%E&b e \ƓP55g*A_Lcd eL-mYPiSCDLIF0I2v2$eNFWt:fH"BDӏdȭwV.&C50 !jy*yۢc#:P5 MU83f.,Lf`"h2+ZsxKyu+g3\: /y9m!Un1QJlfp '00As <$aH* VOq*) `ž' 3.ߊf1((h98sV09` AČѾP{pe3a{pc~P3A΀eOHI ž .@fhrC ND&J fi ZLJ݌XMTR_1?0i1;&xCN _/ 3NlI\2 )`:M3V1**8--kH2}Ƒ\ 73AA9\yM*0` ֢=1Nb)V RkZ{+Z ˎݑ1]#+ g_dGI455ˍHƤfƝwp! `xp!ńZs×ۄ̣52} 1f bT.`Rx3cE%(0a0{&9Fc21ZW9}2 R R RÅxȔF'#3)ZUʵ133H0<+`@ Aj@x5=ܱ1Hf8dɩM8xPc3Ҷ=1R|KPքs; JjDՃQ!9sC8# \?o̤% Vgn0'>ߍF?~1AN'?eq  aT81pn8eƠI?0Fe$JU3nFQۨ$SwO;J b|Q0k9vs0Nm)IX {;bU|AO{#aŒ81 &^< _f!%yXdRצVAL,&WHԺ_t֔ΞUYg`dc`|ƤʩрfB(MKxWI +F1MI"G~1E5x'4nPTQ \)ԑ5*k5z%3 NcՇo3@$e^9-9c y-S>SX=]G~bځ +¸&#~4k0e(1j 8ず|D H AIABx}iXor$$'Vk\1^  *!C`ԠqZ90*Bq) Xs RkJ@x𪽰c Գ11VLZֿo88 E yp` 9`)NuscC|`=c <ExW/ k=۠ םx6 *ڧ0)AG(rB0 p0)( ~8A ''8$ `3PgV1Ld`'0c`pbN3 Ab*  Ab & bR   0`   0`   0`   0`   pAۃ`1 i\'*3#9 4bpqPc1P 1\b6 0`R   0`   0`   0`   0`Pb8S c̄0F`iqA G,n Iqڱ R9>Ђ(``/L#$KĘ0d|} 1\+PyIP38JSUi@iɼiǣ/3(1!a.93,9Vsqc5מ1) pFbH{T.ɳʘ]SCwWò6 XA)0 [F 0`   k˅?9AG fsb 9~ugc#%Ou5IDj /P7&dG(Ǐ#2kI4s+ ԅIF۸(1JÏ W$nKÔMR8fӢk)d.TDz/VreQWP^Rĕ}tRI+q@$8LeG?qzs_n[M)k> e85,6_T2BI3H,W^ִ|ivK2;pǙ,T|' ~)6ɼm0܋)M+ynI(cͨ3TiTW@ߩMk^ĶwBikHV7hPe* N]NҼtT9$ RB/Kr!\f,6U&PT39QSEµR69_Q#dpASyO=HOezkޠn2lV߶]ܶ7=^RXC*UN񠎤jE eiajmRB qj̥-4RQ\هe2LH(J..YB[*2BT|: '{Og!Mgۧ%ZfdԙDBZcڤWv}{~ޝekw}-nRg㷅n F,#g0nQ*LʳQ#H !$"Jpj*j DLC<)R$*Lﶽ6βXcj{tܥ7&)yrdwHĨݣ+yhB/Q{kZm]vݖ=.Kmc!G]lͥwIZ֒rWS*qLbNRRH$E >bT98owY  q$z2҃H=뇤n{7=؞z]7am=%sklDlo.t1ק7Ab `why7-T1MxCS 0QJI^e9.ٻ!Pf !ĂO̥vq}s7;v;=oou?f+)t5^}}.o]toݻݧӾlޗnRoq$CibbP&T3*Z/ nNm# (Q)TJU5Δ3;q mi޳le g.eARikR[(q+ [4.g{ݷGde_MwΗQY\HY;urHŔU),3M;g_W OS/85ֽײ.#[Ɨ?Pڼ2tFMC@!IC*II%ɥʥ)jN_R9 jRYB̌[jJ’l*DhROP0goXF5͞GAq%Al'H`A, P}ޙOanV{t{\QCwج Տn*.W7zrڜ|[+RNrgW0r2ʳsGK ANU,L SkN,%YQ=ɹ5w ?omm~XhF YtRhNsff춝E{FڶUۭ{buMǷn"csؓrGiPlJTcto9n-ǖIJ*&uy$fp)3>U&)97WթII!%Jm$T\ dFyt\m{qY}0}hi79iwj+Z&w h"lCm}EvIh;s=1Ķ;prVHL;hmM>T* )*IHJS3Z 6NCyZB@ )2ΒKʌNR[Tv[nps^hnyZFc7\n!4 Sg܍;v?l^;v./o71" "'lKNgop*PJ,DBi!X_H$i aYuX̒H2v줹7+1#km\H`yY)"J>[g7o}OV!o=nn6-;\ hC\0c "-GXVzCRaܷN'6oAa6bڞo;ko#< (CU[?ҮZ))L)(qE e6K}AM y y))l!D.9KH>2EMtkmo=KyR"wX"+ȡZhEd>`N_NmdK;՝ӽ)eڮa}vhmeuXgՍK!nM &e$-I )0ۏ!L甩ӃFU)l-D0eȄ Imo(\TAWmݫۭؑϵvݎݼn 6C{3 {öҳV0msKo'q/`c酿ono mɴYD][JJD8gt[ti8Rf9Bɚе|$MAS)LsC:-IY֥$DH!)aD)Ԩ^J[Nek4M< vh,6ɬ*dTd5[]~ûo[}DZ١{󵣴`AO1ӚJ:Z/@J@dLPZ\@xR@M\j-ՕHB"sy%JD%H۶úmsF;-nyIiv3̚+{sh/Ok}oR7S;t6>ԎʞݍwϦ[^%՝] 02]J[ꞝy:NdͲ%ST3W =4Ӊnkq!H ~Tg)R xߧ.{֓\6V eZ헰|-]D Q5 1뇷x/~f;'`|R^;iFbڑKWX>%̑!PRj˼SIWOlbRfRJtS$!vЅ]p\-r\G(;H Ƚ@ *t}'zy~z{]n;G^~]ϳۭԻ%ݖK}"E+[,mUšsQ?`p(< jP 鎔4]-Wm*Q3i@$y!QN{]ﺶb|g;$6Q;y<]^`K?_K`z!"F!VݴZn;Ե/g}Z@r\#Hݖ"R>NSyPR˥!KDLV L=VnXjRHmYܓ=frVD*ãF)(1|(F+0f  3A2 Pׇ/X`R T qA&C|dc)Cc0c"D4YNs8e*1kQ@+rF7A=P 1(1PS6 P`'g GM3y~dF'y b   0` f+ haM&`Vz0eIFYX 3x 0FI__N Wg|HH #bW b?ƕU Jbe<p51@³.1UaBm!`FJp`]+\rΔ8=;Mbje0'9e!9W Z eZdU1 R$wA( Ə` >>bcO'F2f77PVlȧX(3H1^Rh%]SxXČo&T>bzξsSU2ZwBktGpb/݌ƠշdqJc( T{LV P_oA~q2߶|N\e7QV t'@'D,v38LR ~X  S_0b4R~&1jeJPT P9pD* 3`_152^0K. @kxG"D`Hz8A.ξc ^HQqp+/k Nx%+A]$|b>#8ApA.c%G4c^5B@Q#/ŵ'3O(H(v鯛iTR VZxb^Bpn)Fc$I̚{hk $JTISH1r32)ʣ1̼;wF)iVtKZʣc`I8FDFAΚ|1Mc̕9HkRfLd zs tA5@!Yb8p7O1 `R c D{eaكÔpiVH:"QkژpO/%T5iC tRT͎>1aqp˝|rƫ$G*b{z`ńZ}}p̞p("S*SČㄒa`~lA Ҽ}1҃,@On5F R$0䨃+9ti+f1)ΞIepq }00J@'&UJOi)Hjj+L'<%LLνAzES2BŸ\ވ0jjsRf4Py,IrԩZcx;vWrZI1Jח!ovRs(HƐb5<L aS1LX q=A,*JAciS1zj n'#8֔>ui 0h܏ gQW?f3B(k50Aڧ# ŤR|"t@#"yf5O3H?x6/!NiQk^`#JAP$GɸiʄfTQSye|bc<% }vC>#~1R >̩q)7AP ``li?n|HLcV%Sn06fxd2PSjOU ^ң<8e' ~ Dz yVb#2N ]8CԧApeq8ô'D )\ L8HR9yl9AI+M8fs0Je)pH: /CJV2.s ƕ_x )L `bڙJ8q"Gn-FT(˯ { ը@\(5ps= QЖ 1s N5KaV|cT?t0Ak~\Fiȣ1 ]W?1$|vۄ)91GkRf($!V3vA.ImYM=*NplA*5Af0#L +0kOq381hҴqdTˋdj3pL! Sƿ^'<`Hs<'1M`$S!Ǎs¸  }34#:N\3A^ Acbm  :`11)0cA `0A A`0A A`0A A` 9D̄0F`0`  A *9DdLΣ9H3]P}9pF6=16c:׍=B2X12(`ʪ 91T3"R6*x 2H PNT ʸAr# l#'LB,+HO ^:Bvpܣ<11%XA 6qYm"7@ c1B<91rƄ# aAc5"F07A`{I㌙FƠ1Z+G/cp|.WrT)SJ8`[em A9x k)c{ kHDŽs>n&Nlc&c @x1)/`@295~)"B7T%1m1h\H6Mڡr7Iaqo<Y)M&T: :ғ!G̸+E|MjLH+2ꨵ8JTS濘\P %  N {Sny;vnʷ+;Q;ZǸjl21H! e^Rw67wE~S^[o'zŵAm\mvhC:]2e9&9mkUZ&Î( o("1 H ,o5]ꮕ6R&j 13$3>[͗~gg 1qesnDӁ%dYf "/އz_ol~~w?bwW_qwɺ,]X6,#kHiʻ]E'2fT̠(@B&$[4 A))EjJI%9',Aװ7]{ov@ʷQDw8bDHdj$=]EȲ ۽>`F>{ id{K}k;+[giTH(dkщ]9\i&AmD>jDn)(QnTnd-JP]A#P H8ٱwo?no}i,VrI i{IwPi&KyJX+3*L9_z{?Ipw]ۛ8K[o[A mہtF]dZ6hwzcͱl8ۥMeSVT$r)%%ŕi{csl! eMҎDVPHIt57BR qܶ]qz{cn.۷ݷ;};\ڸ-@ :ȑ;K}sgUN}V~{흚c&,RvX#S#N7u_L򲳹b@G)g:Q!I@2RJϋ0MLŽƙrW VĴ A RԶPIVd z;O{;k41,nYomH":LM8X)$='z.+q_N;KSo{;xoR;W6>K6ͶXㅖ]m5KSxȴkWZemT̫[uTn'PzmX][Vtpdq! p$RH]˿۾}!}/߽gӍk'E-_, eD^( 0g=ܞzWޘ ~CaM˻=;+/^mĈn{Nض 2%{ĉ?g{uP[SC.&̒I&MJOiFsyڵm)ٵ[y*3f9Y4_ |m^qv}RQsد;Ƕnն[khCu%ܶa\IVo]rMxnުX'ԏ^zy\]S}/waz?lvic"eq,[M[_Z[*/JZ')ʤԥJ+fŠZm/bىB>OHyVRPS¢3(-/6ڶOQ?>ȍpO}=pŢT'RIVLK~x۹=-ߧߥx/>}{ۿl}}\nNm}]dDdEYX,\yqy悐.6nSMH$(s!HmA qot<(-ҒKBJW2Aw OFvwV}R;]e/-Rh J"fWPϧzGeO^vrϲ7ݗ^v;ܴ;~r1aDV_L޵ubje).Xp(EiSHB(5Mw ۰8'-a~arD!NeVkvlϺcņli{x]m;/{unn-@YB4OF~>Kk;7͚}NK_Pv~[1>,cZG( +WDžUʅ)-)AٖIeri RO jZ=ҝ ikJVPZҜD `H`%.8!EfeN}_s>m;;;m!vEHameeYӉ&o*.oSͫ[qwbwQ=H6iſnYnS[EcE2[qv_O\3/qgĵs)gԒq_UdVjuMTdNS"j +ʬJ}{fݣe7ۏuGyz\cvI˦,jZƚVI۬>jwwMYCmq^@쭧jUn{Ch,HQe)H}qj#LmJ}+~O*r ,DHI̥*}Mj~CwM[6qI$$U6_Y K}Pߵ&ټx{fV-=Xo3V4 ]O&?q3x\n&dN{ o66k[vrl[ɶXGZVmZ 1DR?X PJ(PKJTPꜙKKLI)^YY1Q>,Pe=I~ݭ//9 }wM];u|=žys+\^fFa˩qwa'_Lo鷬?Pwwݢk{u[KK(q +,JϦ]7B_EӒVbYqT fURJl/poCn6T "Ic<`dJ\v۹ƻ^[;]eBwy.^\vHY0wH^z;km~u4ۗqc~;f)"$Ckq 1k!SjuV o)MCxRU. Bm Z*qJP)pTigJTN{;.O{^wq\۫sDZhA SWԭ{L>R}UH{@oovh;n~efSG۸Т1)qlyE%-Im* )c3^,$*.i>e:*ZKi(FEQ*OiiL|=(l!qXZgm 65n = b<czݩgTݼVwomQ>öXOwssel8Eibb [Ӯ:N\7o )(6)Ĩ$.I9%ul`-DK rR爟0L[O}nv@]k,BZGs3GG*ȓ9o;/ߦ>UH.>vmZpgkY]nߡ=NQMVMnٗJԟ-LٙQ Bq@) e*D՛/_%L7SPZ$Ca%%@]{Bczm&chM.ܶ0g"C؛}Dv}ݎ0v?mtpZmg>nwvd;V2F gma/.+3,$)m`B*jHKA!o!E1A~Z$Ǽ}/ntkv;Y;mr]QȗЊZj{gޑvzzueGҏޟvnϩ{zz^wgvCsGnlZb=en7tĖ+Wg=;^S.hHVkYXFDXina}\U鷿qvw}8oql<ȓYH|;]"hSz"IeH ZFD?5|B{SF4HVͫB5/7zuOqK7>Q4ϳqwV`7M)oJZ_0kgHn) e*Skq%GIzZJT*RL$T)x_5xZ-$8IJ ;e޽-$ rݹݝmWrmV}ԛpsW9N[jBQ?$yS7ᗱt/Xt5)$)$Hk0g-ڞvy햻ŻmmeL7[ uTe'm7i33o֭s{UH, n㪄 d)AS/6n/L]a)ZuR*J\TRg8D_msأ0J60PSeO3)Rl@><\3DzM6)U8vrjI`{zKM2P&uRYΊe `jk )RJGeE #:9K1&Y %2X8Y'WPEFj9W+`CC{׶fNHQ?ϼIMY"}<ȡ BjOtJP,|d iRwr+MPm)*K8Jr̩ g)P!SH˨i_D gN8\5[\DrF]Y  ֠z9VܒA#(2[X)PAhD]WSH݀HJY`ga~1 bGO߆3W1(1JHpH1QDK|dSD $dce2 ^aJa`2IBF pj .~8`S|dpLî yLfrU`(~ S:q֠ 4523|?n̸e#X1J 0F`0A A`Wm0b#X0:_L PD6u&72(`VG1hƝut "9G3S7PmlRwTI*:\x) CZR (`iS{etNdO8 ꦐAAp1ƱZ ^ H-1fc VDۄ9aW/`1Q 8yt/+$v01"yE=Hq70FjA`0F 0`   h`Ņ|12b490b#`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A.cL)O E5-F`>FI0``0a9`d+1icR 7I0A A`ˁoX߷iNs#h0`   0A A`0A9sȇIϏgQT&!fT 9WƠN[&{Ś.U3㍤%jTt9iPҢ2AHaG#1.iȝpjٌ(Mkg-cH00^u)eC4o٫_ݍrs$?f RQbTV6Кe1)…’H2N7xֻm}̡"`1y40L?j(ǜ黜划LOÊXIvԥ\> _o19og P|`*xF '4 Z6@=Ȍa0WD|6H ё'P323;c)uXs€h)/~fI bɹxQҔ4[a_t2FqĪ9 DiZC*)Dz#>q߶0b~b1N_ ^`Jd3˜#&s2m} @% a 1_} `f_72a0{6KF2g?R(S,s˟ĺe)٥E\9tog>1PsNfiq3FPT}Z8€TV __s0 Jbq2x q,% ^0Lo)Ayk1C?f6I$4| @È+cdH MA҄q69q'M[X 1 qLaYF I}A3j9to0u‹ $ۄNr" dF!"B7n#0b4421@-Pt` V+H)Rt /_JmM%AT(E\5ylݣ_7DF Ԛ<ǝF&dGYq"(0iX8F6R (V~=`: s _~1$gn)0q>1m3<=G`8UL6 VX N8ΰ?qc`5ΜcU%RwFw Wk)bstf SM G@{f7nbPboT}m2DO*[skmT~SxʠaZk:|ƎSϗD+#1e"1ïl-e+ZyTxn23)'4jA|އW.4JW|+"sa0bs9i"d% dE[Õs1P M}x2|@PpP! Q7Z{Hdž4 c +OxJx{~ ŹVtf4#*OL=qt "0c&1`)q_h(1idyc.0JU1kPs<49FF&[bUr1 źE~ӁP9Ff`|8 `ťI5(=#A?3(}s#ƀN2`s:i>^8?0? 1q,)JAYH*Vd-}N c<8Tb[`SL#pN V /F[E+K+2V9%nCOw \gUGUBq+>IkpH!S ) &d 0VTABY\1pl[^W\'2[X))2 E  הB nU᪐,;A _^nq;܋lmaS@#J+~Sw߻֭ZZЋ{5$ԷWTBQ.FZ IKvbP4*QJHJ U,&g2oM~{`wPRߵ~-A{hػQ$}ý;N.ZYO*\61:9M}K~_MFukcWl/Qs{Nqi4Š}L랠wKS#c4HBҐhp7infeY[QI!!e+) $d^{6z/tT# 1l,vIagX+5zg?OIv]~;s-KnfL]o=-u^agPTt7svnu0հr%-C]STѴ}<9tF\XjUe-)t1!8JQ?GkI{~_]o~C<6|3\ߧS\Y~nvgnmmcه.2 -ݟ;{/BC{}~{f}v-.om7 PMwxR].c#ujK-6mA^^U(6 ʨwYS9ΰJlRR-I T(P}﻽$wF]]ewv/N?Tmط+a+o"3Z5@җ]]uqG~w\]}׼n_nqm*;on݅}01%:IV_V}8HS!yVs+3H$ddU/wwhE2B$%E`$fG^9f_OQ{WM;+kNCoz&M2 ݽR5ZK=*e*D-y[z+ov%o֞m6&W7{(vl-mX%=J]q>o>HRX6)A, \9@j*#J~ٶoik#ԝx7-n7?[CQ-{#K4m@rdbޭPUz ~vߪ]W=/n;o;.cs QYĖrGx.v8>oX廖*Cǹ)BD)&YJ(1f_h:IC4TSRU9 ̻^O{I/o6ԖO4p A $4rV@wo^}_|}M}9u'}} 鯩v|t7߷zD$NB^1E?ITrS$>CJʣ0 n5L1iz)̑i8)-r%Kʤ`Ȉ_C׾mw}״oH=ﲛ}qLTxZ(J:x;n^=xfݭ=Z?}RsI7m߷oLݵI m2tif٬>%ڛyjPI 8<<+JrɖUҐ[ &I(9%:$-yh'RTԿN{oo7pI wN̶m7aKPŅL:kzo{݅X^Žvޡz^,p\Gk݇Y叧5%H]-n[irˁ4VU  R#4AhW:f%CM8DASrfI!!qFǴ~ {C{o&6ݖ=?]<*d/hs 9޶XAT ҏU="}{w9nK|=C?xٶ-ѧ {)Hi{K;ٛ:ASN 0eQH!9I9U-Slx (i$ e9Ls߻w0ov}ھwDپA}~ػgo-hKn඼vnYzc5und׳Bf;;8$kǰmþ[[hoRiARk9[<fVgݘQN|S5EZڸTuҫȌ+dH#*ERa~/WIm/Q7~wZoôI8)ݣ&2AGwzvdz`7qs`yy]ܝ֑y [w-@iUTTB˕RrQhs)@G=F]=x`4dBIH$$z |S_ܷ(},v鶸KHv>aTq#JDY7Iemtӛwh^ߊ饸NI-絸 #>rhDj/lfJBdV{,xgYakKvUxfe' z{&ޛn޵V1m6{;vpm"dxw-.ͦu\IV[};}}w[4;UGr]N#A!͘n# ㎾<҃r5M{?j.˳#T Mg^nÿ;?z'Fl`-,4cfZV[*7~wԏbݶF7OJm6ݻqmWAflE'%ac}-ef.Vֲ2ԹMTR 44!V2 .YQ)[ǍG$|B;~˶߸:mqvE\w_#igαY2g(['mݛ>l"lm7wpwvowgsz#Oq1.̰rE24_0eZMkDz#Kn2ǂM`-soORj)/.PRK(m2ʜfH̎66׭Dzm'l&imj{."3g%ܒܪȷ}ѯ[?ſkvvŸǴ4[_k}m/g ]JT5f[^{.^k۩DfTg?8fSRΡylR'T1^wmu[ō|ouɻn;MO0qsqSs}E}iz}۟CIgvwhL66K>w%[ fx RТ7JivDAZMCyB|Kn!*$¨AY2 =ޙb[ͨ:.$ Rд̓#0E9OD{wvK9;mk{ݵ˸{lXgOjr=sϸl]mvwK*Wov፜K "$1,ot&@lҹq>^JH6JD#,*Imoo~ pR|+HR Ғ %F>m+?YwD٬=D>arby{6t&TlAFhygO7_]m}KwwZ\KocUhn"?zޙ譾*mV pmXBu,PBʦ=ˆnwm$4@-*m4 J jHER$v\}Fv'dw>[Fhߺk1 -*$y[=oOL{3j;H;b}om}ogvS[;y~Z-C̱4٦.?>d$4r%FyNd)**JUOh:4u8dJ+1mYB"M2T QH6;ksomxڊJ7E*aٸRHއ]<9C{RTJ6*!&JFbBJt;w/;?e0vԷݥki6z{w,2ǻ#+E˒*GۛwNU=ٶݿl]u%̺tDǹUZ`BVUemwhEj BFU!h4 rLCd.R)uN :R*5L}jcoU}͛fn.ǻ/xdݚ >WYk-`MZgA~zEcݝzOl]Z%mv߰˵N47KFq7C|zN23~\BY5k8JLI%2SCnQr했ŴKB3hD*/a㏱=Qo]=,+ct7Nؿ(==d׵b)uL M՚4y޿gmyNa(6fK`.`m+&f 00[Yaﭜa[ʐΒ)%*@#q+ 6Mɻm-)$%*KNR۞l.(yS-7}z]k٤;Ry*{#>ܥt.6ZG2\ KI繵u#M6C)qw3,E(! S<+&5M3ɷol)RTDP+*RَDHyPRv6snn%8UŸd-%RZtP]i}WLޫmmm2F5-ˆ]*܅`)&Kwp Q5|N`P%$ĵɸ[m-9P$xY* OH!*p ڬ2Cwܲl onn~V6b!+ 'FrV x+I;=4lɿAFKsܵ{6%/;i "F fg.Ű]s:ӧ2$<(2&lejt9pܟ Ңr-!jJ|fPBd2k0q{#Q{zqܰBKOPVoo{Ol;&(n[;^7s0qa[)zt52M~BTZZR2EH#*J2*Q*IRz0L#*di QJ%+3 RT|!YozİucDNUSӕ.V)'&'qݾ|6{k6mrfa9o-f]aIRpH4qR=% Bk!YXu 9!SxVuoPfU4( Fj!DOx%D1&?#G՗/4r¼EFc15tk ̢ݭ#jLnm,Zz< TYQJi>5"Y  %*CBRI1H/#ZRrs$V%RLJ̙ W,sLG,G,Z+z5Tb{lnEhQiGQ%e(!@&&0H01)J4+ dS:> ldARtA0.2AیbxqJR,!sn4BV%C Vr\#Pdd`ǬP('K8VMa+BL˜X5T3Փ19'1Ѵx<}U ,(C Kه "dd,+!^|\d8q1Jr:Lme)3Hmz$0Pyxxp P8a!Jhygr`d#;`c 琭>. cd#:ì3! [JQR21O11q   0`   1^C,1O~v1Ks٤fXIK^k VyDZzzMl#8 J"'!'r~ &RJ g)ei.af T? @P@ 4 ؒFu^޹xQ=J% $@a&aAZ0RuƜrc4Oi q_陧GyXR# 0`  3" Sk2q0A A`+1i_ fpD10A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A2ư38A>1P[`Ņ\q2H(s)1mqf #`0A A``I@ &LS1=k A3< i$$f8Ar8 19 ?ȁD4jk+69HfvA>T\qO|>P`0A* ?8`"6J Ԟ9 R`{|I\j۲7R+=:%-.,}#I_IZ$,}1 Mg)Ǎ?vG8F((1J~qԩ#bʴʾ%I1kƇ<0041B1n3A`-~`FAU`…"ƵH|ݹ P"}<+LamҒe_tUPZ)N9*0HCJ(F?gD^Y{) 7aK q59a s*pi n1!"|  gX$J!ǗōDž'5pϢG3Ϗa8yS2&e-A< 92`X't7}2 |r4560 )ᘻL1h_C¿-9MucJN2R  ۿ|)N9Vw bv T\dž736qiZ<ψw SPW.4`z).~ڜc_X1C1ie@YPĞ#,d!)hi%k ]Uj31[yx?זc$R@kƹpNJ8=pc$aֺ޵S 5QID.^A>j>b&kb7#>q{1,'QDpö>0Rݞ@m6R II2U4S@ƕʤkNxMUo,?V\>0c9Zּi'G4I3J \,lxFhhppiU"pzۀF]бZ"in__ d3#h@+ơdHC[Q)]brh^_jfgDUNAڃiZ⎇gec̬E#!>;wK=pbj均 Qjh)ʩHѧElJh TJa4-A 2{15U@22~)M<%>ʍVe`b.EN|c.y\S@z{`@'Zʑ.$'=*[x"@0 S'=NXL|P܃,6)sqO5 r#* ׄc Zir#n[Oʓۇ(qIcLg+_?q mJg.`}`ߏTk1S\xp+.8uB D'*@ 5 jE&rKe&[*iCZx{9i߱>B x$PkɔM hr0Bs1w `q9A(Eq'4 Wbf0` [Q64ӌ e&bA$T'c)On\xS"[l Fbe q$tFbyO"AN*\N~ #}S.Y3`j@FUA2M#t̃P!CScM!D)-{PeCS0jF8\g12J'1{Ť9JcZJ6HIIbWv2]-YA¡i ˾Pbfܩ?F-?~5B) N`jSYՖ6 ,k'ȣ1J/e8ҘH1K. &<0a3ݐJI j|2MI>X"GmFJn}(I$p+-a@\#*В~n0c?L4Bd=Вʎ=ӆ°80g'7Q,'NBHB.G (#_獀.@GƃƆR SkO _\)Zsʘfyq^qߎՃ 9b\' vA@ȎN^p>\k߷81FO@@v'R%nR)ʵ_f^8ƫ H1Zs\G2e6Hnt6FBM ZRN1a>P@<8\)T|"B d<3*BI1a 5#V0yBό`93HȃI Ҽ3841d yiQL3IN1ff 1 ` "xgQ|p5$猕Pb|s^81I6 #ᗺưAq1LbA A*E #`AcY`` 0c +b S#|f 0`   0`   0`   i3)+q N6h<0L A138 %H7tbeGtf ʨ2 j1 +0NpA0`5NHAAbB SbPbxȮ0J [F`)3#+L1d pF`0`   0`   1Zۉ``A#3 xSF5e_ce0\AG>Í#1w* 3tAÑZ_`<#2H1 DR,AC u8xҭJ&g<$߄kfkkME!|@gfb%  eVsIqW*T<&h>#՚5apᜫ ':@ϖHYJ$ ^Hij72PHq_ooW*𜦆 Wa m2ށilx VUnR9#N.zb KTC䄸.4&2< k~ F4޽vVeމ_Tk,1fIMEf=?/ozKe{tnö.KF1[5$E*,aHƪGvދWzVVI)(i R$,/2r%Zt5yX\4Iv$Hem RO͒IW(* ?/?l[~;OrnRŶ-MYQZmw@;*R@u.l}ށ<݁}g;&˓#朣g''~춻ů=R\lwjv54[k0I [M( 1ž&Ez/uof[ܽۆzLڝ%r4He(xyZ.VR%Nۭ/ WƖfQSѮYM[S'Ms PKFer^n;3;oN Dg#4 рȃ$3Lau @?͓A<#U(Hu5$'~1d@P8 =aY(H.&:ŠppRM:?ޑz߮ĝbom!-䷱7/)lUUOkBjݜnm8|qI)Fe~T-;HKOb#B[ʕ%kGm_e[>w&˵6Go]}N.W!.u n#ǧ #[ǭFoMݦV+X&+X⺖8zܹg?#Z;s=;;{]mU6{8v n]mRE/Yob[#?X}AJ.~9KKeJ Hw|@S(Z*P Iʦ "YLq'%-N6u;(f~tpA,Yم仚[Q[ia_@ׅ~]󰾠ݻϷ6mn{ K /Ujgo퍦客f6idE kJؚ!/2A3 + %j) i87wE+ujPhY @%" a%ܻkwrӽ{x]}cۯi. W%H^gv]ۻwW ۏUOqG`˱o V޶ S=5͠RC+2oLgJgDJ $oۅ//?”7 ѣTׂ*2JZJOLPob.{m_r=?v#cwZR]!Rt]^^iwZlOųVI43N8'e)uOmWlTW(=øl $}kkį︟a#4*!J/?l'wc!ݢM{F-!@&/#Őt&U!No d1VsߨͰ-lw6IڭVArUlRnZle%Aݟ)ppO^ȳ%"fSRL1]/ *maڗKﶸ$Fj ( OaOJ_ސvbLA VKZz5lz K{Cb*4 XzxwjzmޞfR)y#A' .3X\:*m_|UMNl4Y=>a׏V{(9=>v+ lݾv.a:+Fi:;/.~~ڭױ=J>.Ŵksw؛ϵ]chU8}S[fY[[J]i2Q2ZK "uRH$]k}HbŐQܴeHqm,pJդaO{ǷMx]b_M .*;etmՔWUyM~(.V~.(aB\w ) s*gWTϖ┰'Ҕ%_SWWBi6k>rݩ(Yz}ڽ2_ܰi?}@]MDyav=W;oXvW;-iK xoj ,fϷ!-P Cu ΖRX^BV )HL$%' ;od}6i;Oiޮ.Ca1uil xL!ϫ;gǬ.ޙǴ[ElluJ W* (As+U t-_ TUf"09޿(\LJAJ $d g1OO}ҽb÷6}˵=;}w`dTm5]}1!ò~ݽEwOR_mILK?q7aUerFV`p[xN&`VSd.u =!:7徬ATI )PHo,ͻ̽$%"3#U2΄J@_T{׮mnwnKJQ{=+^wg쯮!)b4f/L~{Wv~7>6^/SOO]kݳ7qm ۭ]xf1NG־uiu+Ji+(IJАRRu`bNu bքYPO6)%iPRQ =D{r]÷}қ6=Ww˻^߻swOm4" VZ_|[m'ާ'j^ѳy0"tmgӨ;X4׉a7]9H"s:'0d@',)o>޺%3+Sm( Rէ}nWvuϪov}oϵm%Wuڶ]~Ƒ~;>;LbI"Ӊ;Smd7rͱܬFGݾn'$H7YQ2x8 JA*XHOsIP-u/~e/QJmȤ)HHyYQS~yKx j*W?խSӒށlTD [:V%RƷ[ӈ6kBpe&sI*Xn%JVlMk=?}F~7X#ܽ5k],\Ok7vvvlˤ4:VL oy_zoފwٹ-C[fw k^ ۳+ @Q}Zhz5M=V,~UTdJI)&D5Z5kBmwd+ [)*E, ʀFRNT_{vLka${%k。I]&=]m>zyio}6{6;;XsnITt៩:w-ӯ#K)%(-R j͗N[vsܷ))۷X%>v$J\o#]6'^]is-b}I6(MkqgWo몇RŠ R__]ӫZ~__Gm/Nٽ3ow{Mhc}duuܭm%t錵{玗)IQHm%BPNT*JJPi?NO\.Aɂ^$-3ȼ1>d BϦ߬_svvV]ŴwpǶ&w})q}vm`B J/v^$~Y;m/T{C{Et=M'-AnDetbS:zl\>˜BRYBV\HJ,8'"2iw'X[ f-TB3( %9W0)YfIInյޅvݯ۲CA=/o>RH;͸B_ebh2_[b.vo\a޿zQsٻ.>av7;Սpc}#n[wrrRoH)URwDwpw<P*OTT ?L%;_̧+/T/6)wy[F-3nm`G 8w;8E H2Lko}{=>]I=~B绳Vg,,\߉VTvT1-SZbTo.*P[Kb<,e0?Zl5t-4-c LLINY/տE{&Ԯ.>Nz}}^o3,zt:Ԃƍ[ 罻K֏U'~׹w ]wlf{H6nw_ ="J^bE77`-Jeil $ Lvg>7zܶrncu=EͻZ(I7ߵ>;MhKkR/_ͯ\{ wwy"m"[׫4tŷeN5nPFE$6@1M1ӭyemnVe q(*R[JTJUK!eG`},wm/_mMo[y]m$>^ﱳE797NJWzOkzmqw7o6=zW}~5լ`XOowm -m%PzEՓv4Km+q^[kH͔P@frP)eqYHmd*JYmRs*s*df6iwWmn]˵zlWay4d0/H=D:NU+~Yn;_x/ ۢD7+| Z j}:vvJ BT*A*\JJ TQ*T- Ma.ivURqE/dTTWQTՇrޢon[EaoiywXt?" % 0͎id? xEc-~/olۻiWݯ۷;[;Ȗi &i#;w` hyn~Ф%ҠqBDy |(RԦ2uiRqͶn7e 6 !ࡑrPIZ8k%k}Gɓe/[uvY=˻+wQ4v(4:w}=zda{]-yEG{ͰwU?Xn fVqyo&Ixw3RW49*`+]PP\ePR%2I$ H$X{ٵnP#)(qrĬu#xZPF6^_T~"vdv^=ݹoo~nM})V [tfԎ @GJ[ԧRRSb Si(mj|VRH*Q-yʯBRT`L$)JRT%|#1V;n;krC_XD] ȃ+Wml)iܽvum6͢, t Ziw@m2)9UQy(R"pS22G-C b&dEH8`SW e'lu^RB'wc#&0:WOSAOنm\_f  BN]HH<{"bjI4#Ir~~q-OkO]Ns!:Ƶ**I<)!Zs'!a.Yd@ʒ8WQcjᔩ ,*zFYؽK7<:aGZThGUJ )6JuɑZT%J 3hyT`A,TԠ6>lYؼ]-$0YkĪU="5mf{f4G*]Z] JV2Zs·1fTt2"e*M'2Ĉޕ'Sxo a"# 8 eHq.+ AkQa0˫zxxaC.L)x$#NRrqS DAp)1J{F% { AcJ ,`j|O߂2 .PM@lEF6JJQ9WF= ;\G™7]O@tE1Z\!l=$(S%3ܶ.DQ%C?ga¸oթaMrŴZB>~0IML8h:J&TEHH$,jA5\\_xg#@8'pc3 pFi  O0Fs* Sk*ApFH#1m0N4)(q #`0A A`0A)0DĠŔ#N)" S`0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0` d/oxƤL>1@20b*i_ b3:oxRN'1v1l䒪q7 0QQBX1~|ưFp`5_x}:cdx`>%ȃQ9`*PpbC.9v3(8.ym=#txF 5>pA1ƻtT:e*n-PihL9Kr@ h|0dRْF P R@' WLFj(Q0c!`$1(î>`\C`V(p$~ 6uSWl3-tpŷ?,ˎ2'zTWt.&4\eSJr M&42q*슛C,߾[Q>_ 8lR8r|29Yx1A&\!gJR0HKW?p?d01@Jdk2&kun+"<og [VW(1ee8]@ * W!%%50ѕÆ15Xfk\d0b#Sp#!Nus<2tCN'Ks+ pP`gـ'(:kM&q]o#ۢ \8 r1Ab9S{pFdi, H^=sJ fA5kęYcRNJ|0T9 B>n R 1c$(1U>oˎX#rb 'ԌpbΌkI+G]'1Ǻ0$lAJO4\s',IN@<Z `(Hơʼnjۃ12n0 FV)qRd'|dMBhp* a[\@ _F>ev<8P>`Ņ|*~K1;@NcT*IRsfaDϖԘg ~`@5PDe MO>ŝ>”#82g Źcj@1e:̍yMLԄ֠|5>SnJO}C Y $+BJ [r-0F|Љ(˔5y ڧw.jg 5r㌩9`Q Zp>)qAB$ӑƇ!#6cAb*3B)lj3(Uy<܍a593+8gci+8+mmICŶƒ rʇHHm6YANT*s{MyP`5&&8ꖥTzxrf#@(0.82`M[ńٕ}B2ɅX RA ]d` S.rN (xxSiO`Ŵ~24Ҭb5AJL!q/V`ܽ_/ R@e͗5~vӷ e4"JeLxlp™O[ACyF& ^iLI ThƪCe \>*nZc#6JC n-$y Xx23  E 8i3])l`ŌG^{0St&1& [+̏x+ |-^OIqe <ӧڐb4Fyсa3nXM3~؈1B #V~{8ndoî kVMyRqbֿf0qB$& ۞X&^RO kBjQQl">'፥8Yl1j5FQA.Y\eZ.H1~~}}n07ǜ:W 2aB Ô %0ccW+Ot"Vf7,iK1CLx1ZJY=A{}8L) }!3`b  oc id&d1*M89c`8<~Ok13c 0Agۍ`o bq0cX 0`   qDb S3 b0`   0`   1P݌N6& ]c`X   A7A b1^8#5U0qMDb~q%L  i(A${*S^0HnB{ R`(2`YA A`A` b0r,mĠHJœ` S F`0`   0`   0`  &1)1\a2%.\LJbU3@iL8S3bbdn8c2ur4? sn0bCYS.F`Kn'L BC6j~Π aCWJTTS p(c6^7Pm70 q.GV>.ڞ}2RԔYvÖmnS4))R'H ʀ*EgeUYP=~n+ͦnMoǶOeMJ9ĢPg7 ZV/vp6XyM1%oWZ{HE":J0 ( 0xew;q}/Bcspn&DjjU'eA,@;nKpnwGޝE{[-ix3Rh 1qt˭&|d$jQ'uaۛg5>PH)$e:$R D~vs_[l]+MKdI = CZgoP{G~6 ɿc׻o7+ bK.4IO涴O*A&`3KYFi^[7 /m~"lݶƗrgVx߫I$1K<_rvxZ^KZŶzq ݕU纻+ˑ -.-MptsꯪuN2JP-H!Hi/0*@sHJYurNS !j[Y-) Kty9MgL?;Fo6!ܯ{漵ڮk>٭즔ݹm+MG"QRId}}:!dRY w.ݬAkwm%C jʭAz/>PrS:^TmkJҕūz)'P'rPU.R.S5fR2̩맮1ߞz4{t– 7ܭdȑFsw =}O6C-hx6We+j_-bq!fI+QS_58L'"^_YÚ?P}eupWK E3'þgÏV=~OO=y^ȯ-o9౷[dXhtdDpMt{v}ӷ[=i3͡pkX qmJpڗ\vRl3)Оĭ W\3a,5V.uHʄ2r. OU/q}O;O߷;mBɶ7Kr w̫ 3o-wk/hl"]EV)l/m' `hd@:Vzw8Թ&ae3J*ʲw D*/nJʏӘf c==}Cw.臵.;.+q(zi7 ӷ.-n4O{^BAR&j^PnvVkM/Ym`3UȚCWNZ! E3Kr~I~BIG>z]7l[v;:iMkex*;5Vg=E\marvG/mocc>ۺ1^l[̩5>ZE'Be;k]},)y"JXZE_"K*,|JVjLNU[.xs'ʤN#lwo}=swdwFW[_qv/e-ӭRK1ۼR!)]!}9^w&۽{vlܯ7찊K`~b-ۨ"7/ Ԭn*K+2+*1ҹ:/XևT_ĕHv+xTI=(߽Pe=N=o/hmMp,5:Ei"XYd&F;}}ſͷIG i]Ogn[ikj {jiRSh_}q;U_-_T$L4))" %HR]KDQr%hJH&T(JZ8C}co3vɸ'w7~vM  5%"IIto\'_֖ӲvޛGoiaM1ok;,I 0I*q,}a fKmpۃ(8GJҊLӇKYanCj /ËZ[boaퟨ'w ûl%?AjZ;͝'Z:8I!`+T K}ޘmm}@wrnpͺzoeWv6-ŖhjgB$;=/݇,lH][vJi@O!jEg4PN_2m_Wt=q'R4]}6ٱm=zn\AZaS#Q7^cֈw cc3'v+vwO>xQ7I.W\Fb`ݏZQvGyA9&eHP!RJrJH K~NstT|9]YZB&|IQR*Pc;ݧ{Gk{p<{ws^wq%Ylv Gh$mZˢR̭7Y-?迧v?fvNޞvzs}jŵ f ;z}* q+kP=G]Bd2%C S٨d0eJZR8>\ T|% 2o:djp_Qnw]ܣ ٶޥ^g/UhH&;OO}?ӿgoCJGh䝯;=bwG/[g-eџodR]*nV;kH-0۾5{˕yYf<̎9(4=hVok_WIA*(Q 3ÈX4ZJZNT6oG}7S=Sܮ>{c{HnJl1m{.$^GI n/J8A9 Vl(E}3;}}zX7OF wrv۶lޯ65=Uakҙ4=_{zQOjbR(88!|[H Qrӗ:5{':2 p,U R4Hw'}cR=ʷg~wgsB6bnܒ;U;mKqюGr}D|co~ߞ9h7q<RӨTC#w+ il [Fρ)H *\(!( Е Ek\2Ji&c!^BRHKu $կs">cuz pyI AmB5i$ԥAc_F}:Tۣc[䔴ҋwoSnzcV PRy+׎i(㮮Nl,yz[+}wq>kkkѵ] ww7iKHdVJ=5 ,;mf1bP$y/UDG\T,BVW,&:~fқ6Jқc^ۥ7.ܚuxyn7:Ie0άYRuN{++8_owmk dM,C33)jS;G?makd>)FJJSS+,Wvj>ww4mse& r-n[vcVJ1#*fĻm#G-&x \D 1FڀCH}KCj[ tdR{%#S,D~k-ɶFӨWRܴRK:R>^Ryo3;,N]b%55$ҟv#֠Tʇ#qdSD~ݑBجKZRkڟ.n#rBw V]+EUN/{b 6ѸvVKd?b;poKUD]U1H9zB=U/ENlPIMZJeW΁E&2'UPڨdRIĉf$-=ŵ}Q}`m]G_L}õ͟m=;*M=m[\m, %L4gqP=+흂vY}ry}wawhn;7Ӎ攨*"HҪs]ivکeA)e? )nKLIvO!-pW' jwqk66ӽf=nNa콿jph9Qb=h-Ƕ"K.wmo}5UVt;s(%=*F'FRݹͺ  iL,bk29RNmӞU7uoIhK5o' ܖ)i6)gely#k+kۋ-OR;|߷HiKMvwc)#]T)#I^EKڽǘv( M0wHR8C7͸ժ^ME4$bsJ;'軷g{ktOMܵN;Q4H])U9`lgswӧhsi^wvI;]TQX]Zzey>bmpKC:0z9WUn@Z[BR Ӻ굵n{fX6۴̪$I?Igqnܻ1S~qò+ sTd"50! ISls"RJUDFy²QOܸ.idB'f42.P6~Nװ[>w{|Ro!%&_2)741ϴ틽wK{TMRR=mhB]n(X^kEkfl8?@GV$/5MҪHqmVU:LPSyrqٽ{+i.m%Wd;uZ2On>uּn}}Xvc굄˶ 5QtK ̏$~){ ֵo#eQS)|Կ^nme;?OY7&X/-vI!+{f䄂cZ= wNfe+͖fy&8nZҨJĂx)]j7~jRYUi{Mjh[u,@vl^fla;DZvDRrl,f15h[ ,2ꚚRUW% ^^'y(ުٷV͵zJf#8QXmַ{Xo{R]ߖ+Mt>ٸgӪO"rR{d6LT^OcJdį&0-#äU7͛jVv{PA5˙ o5-T黶RA?/6ReFGEv7 ~} ʽߺ[Mlֶu[l-+I6uր!\r՞{KMOGwv%]ջҦ}G%-t„t+OEEAbUe7W'KjBH@VP@pH),Ym=9jյZR\8JHo*gل9ٷ9zCzh_Yw^vl;wn6Gm׭ea_RcD6U [}%O_a;?b/bIwK^Yvߩ)=$ج-EYw<4t0[TI)\YS2ϥ;Ppۏ dG-.xGw]vཛrMe?/pvE!(6LĊz̳IF*hO^~v&>}޶?e6ݮ"OCJأ۬Eii^HgYСtNk7d+NbJAZ6K%TIQȌ/ 'uۗtko9YY\4q2%Leme$kz{noeh.P]ZE-B~ R%!'evzM_Wn_NR ˹.j{NqZ(R//n.DM,l4f~:$q >c@c(Pu.RR& =kta֝h$,{$%~`_^(3Tk޷^/k{-ۻò{}x]$dmy"Okz6ӵ>ޔ}Hw't`&; g;bo;ܥ$ e'o8l7٤T2HdO+ԖyZla,'QHDa@SIT_jw˽SoIm#szx}vohΌkZ;{W֯H;{}Vz>\ou;g[_;۷/vNj4۬ HS8"b5'zLUE ueXf,SjCVe@dwERm6mdNJWRJ )3T"0}@*N-,|흾&?x$uS =5_=:ϳ=n?Q-F9qZ43Gk֒@u3 ic4t_Ȥ<&RC%(Ʉ8ʱ^kۓ9@+QȔ3!)$FܾnCw\Z p "\5Tzܛwn3]׾aԟEw쫰U ,Dqe.Jiem6-]$'T$*%sWI Fiݬnlqmfht!J2I!$J1v]mݳZn%ͯnov6k [m߷5K[fzF ҇O}f m뼶?uGӏǥ]};e1ymqli2EZA:ƕ"&^u4BS))"`Ρh>y.lr_ ҴITO rIѽ闡6czpٽKz6ӵwO-qk|M-c淐ND,Jb}6Z?_ANnrڞ}og6pGj}Coѷski5̉VN 5jJԮ,Z-"V^Knfe[ [7p,-/m(!j>130I$<^&촴.z+cq孝Nnd} f%.vzgnokڝ.m4QXm}YOyq5`DCo$%CԒvڅ~b2I2)&D.yof4OQ9ԫC k,HRB/{_M -{5"+;9#hL-EjWinMqlNKOޫ?jǸ=PmtݩqyEխvvYo|ʘV8ۅvT$BEi $<%R2W锐TAu*%e76I (Ԧ 35ݹݿy۽mHzaHucn\P gCM թ?QQzwUjנ_V{r7wd;em6l{ܗ6V(FD"a4io! ͧ&JP@B@3Q2I3Q!QHsR0-倦*RB@ %j$YX6_q3<;`:W. 5lܝ˻wwlz=ee]zgezwֻ}uq_hveW˥OI_J-ԦPm[@e) D"ʓ9}3ZyVy Jܸ-(2hH!N .sV};nH6˙>[l}]Ϸ,RJQIQƺ uP)O=]x=.V-nMnں/ioM_tS_dWg4^%7SfJ2~$̦GVu$) %jJL"/.<)Hm`ȓ%jae~jv}C5Q iUlX*k*p4<ڵջ[MHeyCS2)16Ivn)vhV`,R/U!Яuu(SͥEH "AXH" v+Zk'K6@ΓC14?YCSnL7{Ii)hʓ)+e^ .BR Oc3 !2I5d*?%iN0'H>ffAWN^PyI?q-|qG1^)5 B7ͣAY c @ǯA Pu4g, 6Jm(1 Dr*0/BYh <=:a)JTDRwo3Tjk0c33T uRʐIǾQL *9JeFk)S킂 VxS>dWp%yDa-嗅yPRNjA>.leQL"~ڊpKy -KI.ko>ky4nb* \PYDX0ebJ-!FBÄHoRbd(NDDTdsMT*a`PTƄKm ŀW>CH1BkF 0A A`vŅY[ޥھhD .yUÐ4(_5t#ĥhd\J_*RDLc#t=4I: Q XI>9LT5{G/俼H{ƺ! E h%Pa qK9 փ i.{Wwp~e$+xF U$cV' b(y%9rO2`9 C81\y #'1LAQ 0` RRb#X0Wff #`0A A`6R71f3 `0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A\&e2 Bb ]Z>?¸( tq?f5.ߗk(S46ۈ eJ2J ٓJ3Or2뀒NxH1`$pq|B  58UʁׇcS1F-008}lq a)ƵJcu >n?tTH21dump|}{e\HT0c"ZWBTUN&O*rc*VYo}M Ů@27nX1c區&f3,cZ{y{!5s1# A`0A A`0A A`0A A`0A A`0A.- rJ+\81Lf5?f50 `Rʜ1"b``C(¹s C(H'/փ'֣,j@t,*yE.a[|r"pHN;c.YFTǍq7ngq|WnPb=RF<)v11;3r+~xЯ9M%癯+ U}c&xAUjZ܇DVASH?f_!BX}=a(gᅢ4Lac0PX ̄Ja +V QPhx9c"_5s y_o ^2¢֤FU癥s8̲ ƙʕ6zv QƆ$J ]榚rߞX'8Ǘ ;{'?="bc2 T+׈Tj֣8@$/SH1zU5Z{*8煔X ySH|p$ "Q#9 Ԛ*@Q@C&PhˁV d3 jʻSPa39~883[}yc ,p<ʿƊJ%Hk9!Cf1#V+\6ᥱKR)Wn;ťwrTѸÀ@ᓎdw|8WV*Rn0M0$ZQ#]0s#49%/ c[fDOtʑ 4΄SIB!v[W Zi%Dʬ€Ï";* ]B8r 'Ci3Ɗ2&)JC[JPb {r9T2*!0bp^}1Q &1H$S<(D3vm8b)_¹yipk.~cI3K.÷^0b[H>Rs*ң(.y -ö1{ 3,m_*M*ڠ*0`gG%卂 tA)) -\~#q̂"qƜ`4B  rbH$15R]@jOë?fBЃע{s PPqR<>#ƉJ'$SXYMs'tLd '`FFc <0cu2O31 31sS<)ƊpJ81qeʕΘPiqʙwK1rFT FYSSO|N}tO5q$h t<v2aEO- Ž2|=!Zc',$Lb$j `V0)p*゛3 >t1wC*|x qh`xR)0A- חݍeX q9 ,  ո/ S݌A-jc `QZ{%2v1UEgF++^|*T lfY( ` JO% X# zc2W(1v6#(hGD=x#lT Gc3H1L0A A9<5$3~8#8o${Fe S3rL  #EVE:$ҵ/4ʔDl#pw0CKU&ku31<k+OMП%ңZB%Ds4n7<'O:Jpc}0+S>ۃ˷lû}1"׶ymod6:`RhM`vU54AYC)hd bL̿&%1пߡ*>Xm8 7)%J9DGvmnsq?os`+*C6UӘ{vlt~=5ܻ~l;fKi;ua6{omgq#"Y]MA_:ӯys)U ''Bmg:LT_ȑ1C2U cpۯx]voxlE;]%6Z)hRˢ#f͎ߣL^QZ;>۷{ao n6}tydsbBe+W:NŸ[jy%iDNQA*!AJse\1O J@)pj+pi(Fu(H;{?Fcs duK ;-n(VI 3)HOobzwj=۽gvnۦ&=k+9vh.[E(tHd|꿩^uK]3IԜyM%Y.,)J4&[qY(KkB s ʄ,O!Zz=۝ީ[ж]ٽmv CGn4sYڋi^$YU\UC.Zo{ tGF..f3!i[ %A% .6-G̑M 1In]uR2 _R)Z%+X?i7˽\.װ.i^H* d{OoOW6[-!bXUntpHCZ¸E[RAl|>e$!k,*e9LSlt}:n|ISQTS4 ʤF/V~j[o[b!}b$Zrݬe], \" 3I69Y/L;_B!v~*cN;o۴Migp,>n `tktFjJIm$xA@/( ,mJdxZ%sP4ỶFfYW{o7c[ծݸV+۰nfП0^aE\fF!6bWK';'`ܯ@Sk<[\Mw \ƶ{C%5ڼYb]EZ؜$#{/dcS&CfZRLe ))ƥ߶v];utmV)g۶.Hә<}1h}Q> ڻk^~MfܳsMͭ:jJޫ\:Z<8m쭪&KsGwec4($@![Y&u{{lg]wsmW7vn?h2vsypJ+ 3>+ٟJ+i;?L{grnqvݿjnnbki`g hxd(ᶧ辎-\:]m!-;&_ ̉=SUӽ(H L2 M LQ^X_W=ְFٷAc;^X-q|̐mWFwz.])!>}K[nkԇjzovOSd.d]`%mzkwgWw|TKUמ]UI[J?/T"_3Ew_=.%qqf$,7Ix'fs$LI&'נ>-Ǩ}z˳ź^io^m䵽sm-E@!:Y"djҲWW +foP=3=$vמWOG..^`;Uu r[.}P.P6ξʑl! 2yN@gJTTEfL..ɴ6RVPBMDM)Ի^vNߝlޓo=ovn?6mܯ:2Iv&㯩}fv-mgmk$N i ɨVRfIoC͜%sJ><9W^v7Q0eN{uG]Ǫ_N]޾{mɶ{-WY$-*ͦٶhW6 6hR! -%ZGpuKP7ikGw*0J~' Aۛ%^g9Goמn=c;6;&#vضz[gp]F\5ǫ[_emUߨ-.7}U6g{wwLzvq\"ݱW;=|i^\wjAmr鮬Ԩg;'itnvIno[6,덪KMaYn"5(ڪ3K?zq5tUMyJqԣsee{ISzOjNP7ee̓򯊅r0;Gjg,^kx}߽j׺ZmJ"d</M6mp"m͸mKuq+s7I9g\AA2~i6+ܹ@1J+jӵUKe,%(O[=9M}}-=Ei62Y_e&QD42 {3kO7[h.6tT߹vMv{7>i"U+8(^ͥ3uiiԐ3%Ԩ$|RER2:skmR)>AIRgI'.=]9co;?z]۸/ܮ_;a&ńDj>A;*-mʕeVD*`!>2I]jQB \Vs+*BA1**ޔ7mznܟ-oqw}nrqzzs "=۽SkowBlp@!\_`ܾ}I~kYXvݞ}ո]lXOo}o/}y-;"UBIs3J_IUsZ ?*S))*RP$sN4}3KY hSA@MAn%.yBZPz6I?gol}{{;[F$kt\su$=̯es߾\fZKz_韦ݞ^lݿg>.ިw`m,݊kmMOsgI2I?BZ{+:)Y )IJ$+R6@!AmOF5;kZmHm%!,%CfV6%.%jew~}Ƿ3w߷y;nFhonbiHW1P4ȳ_do]F"OQl_PnbvNnK?ٹkug -pN4Q}=okj-|(KI ty2\ko۞t!gnʜBO pfIۉYQRs/{W>ձX{J}|^zv-׷H7x7ۛxfm^E-T=#rC}hvn%㺭;^jGw{o_hK"5I}ґr=1n^bFt9'*90u]:f .$mWin܃l#uvggi{qo>we [iwYdqՖ1 EQqbD7lmLߺ,A^6eE,crJݙPa\7Cͻԭ+ORLq; vnыݫ, l=<-uib{YdH-NNYufVs3%MdI$q#1 -5EK4{o$ӫ@nr&@S,Wq~;+}>dzKeWg]$8la1C$HuPi _̈́Dj?b_ FNEKBai¼Җ_Q ST8xvޢVimǻLר=R5 ^nwz;UǹM[s ܇XUvH4iDf`gJ&ݷR,-K#1WF6uiضBx/7]ئ} qwvtv=ѫcIZPʍo}(%{ٿw>߻;.헰{3E,ޤfŜHVQi qǀ [E#1R>O p2?w]eKtxё(CE Ni 3 B%*( ?Q;?{R]yOxH;/j›w҇-UCm4gqjEͭi=^z.tޙw_Pޡ>wvZ4w3\pu]S:zv. Y}d[JI! @pJ H .83.-쮵]zz".|Թl$JBCdsHR*WEզ7=y_-]{{Acwiً+;Eὒ7Tkq 闻d;[}7v}A;wnM]gcqS,bX"G; u ^[L۩A`G0JI&YM@ƮzOo ..iJiAI%`db3 P{'{[$u/6X{yn_RT'4jZQRY;[o}z]m;|޽vuwܖ{kv7t[6wXlKܡ+ s fm[7p-ĂB(<֒S$R{JQ3tQ[g(NiM*Jb ^~>h}a;]ϸ{;UۏBGvlnCg[)"u!/#~@KvG}dbnﺟdHwoS}87C{*6+sErebN /_еKT%n8J$Ȑ&BgOKjƐyx$%Ka^>= F6{Ct乏veXZ6˽qfRFձ^}4=}߮W;tzokvMwNs1vwCk߻ z.n ;N!?(lK4٫c"TQ" TD2T5ŷ_Uvֆ0S$)(RHJ(4K]lhi(Z÷aݭv7hAhđpt3X鷥=[Gvo77] `MJ˩%aHj:Wڛ%tAH+O1"df4B;m'!K!ICMI(O7"sdR k>l> 5mY^]]]6l1tqV&uuK;P@ޥ}NoX=ٽ^wקD5ͥw_+cT; OT;i"؄+Abr)Sn f&AYh_bXZZФ)NZym?|[b힑z{eѶ-7~+%.-扨G۸IHk~vznٹٯ7|Hmչ]~ v4lz`M1-kimvlp䬦MOQ Vbs Ugo'lgu'P xF=׿eZ=g;oNgݹwbv~pL k j]G}^~m8)HTR-%j@< Y$BOKZ}n5l)'%ZW@)Jo$S{r'm{.ͧRs'_hk.֎dմ^=,ͯDgگ{'hpe7(6+Q%ن+Wh`j aWlaGnJ!iB@M*:ƹ^)߲^^PʲM%GJBV\Rzxo7Mk P5֑ٗpז4i'¤<^YэՄ_Ckme>x =ry3Mm*G)1F_[,no-+q#:@|'4.dB]u.XXXYTIZ[ R<$6euՓo,lf 2'>{w}۷m-qطyWYդ1m%P21F"jl[B5[W-Vo4"\̙+/"&jko*”T "Hʙ2I2+x # ynу^*4)j8=?詓+h=41I;m{j!DoBҰe+2J ^#~' QhmC }A1Z ڰb(L^BQ2_ڰ e|ڑAiAyJ0&q<*+4θ2 | $d9y4'ㅙ[U 选AUaUO ̓\+pN'ͳ7k^<'1=0 c`0A Aa]yh\*:qFfv d)m5QrݐQʁUNC&&w0Gu^([YtU $JfL-d;i74H! #$JRBDWSE Ls!& VIRB 0f|LADɃNcÃF顮9o Zs5jL SR   `G0A A`}d`0F 1Jc3H)5 0`   1i ƊL Ř 0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`  0F @1:1w?{1,;R #0b#0b#bx8%xAlh ̂39c =~ֿIF|Yi f1=8J6Z/5c\DIU#TjN Sύ>f1ZT8 $f Tqο#d jTpR81Ps':~e$6+ࠑ $|F5` 2(8j@8u1rCu\`Ÿi A`0A A`0A A`0A A`0A A`0FD9cI41M<@xqybSOd'c6@ۍ'0c 1O}y|1;0a.\2pb:iǶ TxL+t?&O?(v-N]lEjQx4lyLi B|? ] 1P0^fgݺAŸ4(4 QIP FsR bzV"f7ML6tKsdZӍie!3ق N efV,rӕ6goJ}Pb 3Χ>VYB+Ƽ J+O,kP '4Aa@?O!·3bUr=m}bXK jO s1#A/  xӟ6LCH9xVW$Ď0bu${u#1^^8*Vԃ Z_mcd-)N4Vf!:r'? cRn0`Zyk0@9f T<<#QN1z4W&.@p)b1 1_Cʘª $Jˍ`",h){|V( qToz¢ G]5,R3m$Yq.~? erKw01A)O}Oۗ |^9Bdr e#1^1ibNydiTb?xp@$F_a3PRxe'S^1@h<+5$c ^Q6@nSo~ C0|"[1@ Fƥ3 q 6Jr1˦1L}2=0a9@&c|%' ŠTaJUkeHS27 _HH)5H0TV0'*qa埏?c ̣3D}c|q_⋋.N e&t#O R?eӈ>(S!pTe@#cJoۈkS_/53#+SPViϳ 3|=R5A fFyr8C |R WJ>0g׀dxgaȡ58/r|1<ܩcS# N3 f1*iQSPsL[0A aPA2)0`0A d bP1 A)e10A A`0V1\n#b‘0`T`ưA`0A A&7Jgbb A dA g ` qDfF VȚm0H3m 1pS+ ( b) ̆ @ɼr~0(twA9E)NU8$ ::``T5sx$uK|b<#S}S63Sp vW% Ibs!+O H on3*包&R3Pb? vmq_ڸ,Bkn+LA'v=41 Bp`0A Abvu1Σi6xR38Q41@#dpsƓ#I ]XǹdGVhLN̾0ĆEO64.ωO? 7x{R 9Z,vՕ Yv UcnI1kW--y<[Ipq -7SBn$嶵L H2&F@kM;,wnoeմvDWcBPԀ}Y[ C m@@>b„4T2+)&%UmJj+#̙@$!"2i,RXCh#ޚSY]Ŧm==$Sz,Id=/3ϥYhUح=٪bĩiymT^ nIKH+sfGZI3u !4Q>3o^ݗ VMsoeݹgֿTC27kd7T?SvQ\WdvgjGH#=p4u爐G4Z{Tqk/02 ( W[oWj.m]YҤ"ʶe!~{j==G]}Ƿk1VY`"ERޭYܾ~>,wk?և7mn[fw=e7w渚;g[v4ok:E⒛29R_Υ'*) ;۷'-%/efZH ͔b݅{-ꔻe{זJr}ocgnYQڻj /V>xNzuzywl|l}RϺC^%{[صĒQ-y-mٵ*ʧVjLܙJ238꒴͕PB\@qM3P HH2W=Nkg޷>{m-mm>wDCuwCW&UPXD~s?җ=vӿ|wޛl Ō3kg DC,; zIR˥sRNRM&1Qu_Zm @%IZ՞"TgcSP\W[ݞ=:훛~Nm}ȳVf{o'hUЬHY=-- NoCwݯou)f+;e|$3Z᫾Νn[ӭQ*INr*BZjk^^ݠj3: _ S˰`KckOܧ]{{]c(LD@茣TY#o/;볶6Lv}}>wh].߶˵v= Ş[Ni =I.ү- .ݗfZ('2Tt(JmKz[vѹԝHHӉ mEę Wpiy~ݣ_Nߴ[yc7mF4 S$>W}Sퟥwݶ f.nQ$ 3Fiґkaw.ڔWh'+i|+ %왵jKK6d A()esNIfuv=Nﶃ]vVw}6}\^vg]\Ymm@H_8菾 vTW*];՟Si;ONoeK-IpR==B~עÎ:-uo$WsѴGHKAˋ}rrAMd$ $*G՞v]ooUOP kl6"ڽ&׌InwWuzG74?e;f-hl[6womS#BD.дYPݱsd֜žm %9 pQ39T*Iӽ@jݳ ZTVR!)a LFl$0aݞ=(?Lm= ޶]w(~s{F.kmi =q'ETc'u/Rdصl ϼg{{-f3%R6~Xs=_7"?q.&I䓙N6 3G"*cFܛ~Ir)EFC3|V}AwM6n7{Npd.~ ٻ|{5kh5':ծQ7?I;;^Ӿ|oBwMr-Ӵ;[{mv6+G fQWz+նnN}8mZi :V,(%2n,\h [SJ Tg"mjQ) (gI\~;s7?[`lsiK})7n-ᕕDo]֏(6Ovev}0?l^[k;l_lYLwHeaDYT?\}BB&\RHLO͚d*7ӽDQtd\ȕWxR5+X'pK3}^=qo۱[k6Lo+-DVV|6ӆ#9tmB]Zk'IB ͺx7Zt[;6,![_h+++D,OTzJKLڌ&Y&Tr?KwZ6aLRA3TO1&\!>'=5]~;nӿD7=uNھ?*SnMŻEu\E#FR@!*ywI{;o=@د}O%綻 n6>nԴŞS\YFV.;|VG_/^h٬֧ra6ב!? 'uy77sg^K'-I*Rp H%)FBdOkw;wqwqwdOOzwGA]W:V{7Z[H̑HLә Lwm}6vkI^m[g- =k܄b;.H^G F%uckڦnxMH$-J#ǛP|u+ƙ I <'7辫l'͟I7MKi{_|ޯv[ǺrM1CoM$OM JXۗ~~_~O@;ҏPR}.;kp-wݴ`+is _1Kru@z~E-M΢[,N.!hpx3@@9_x?zӨfDČhg2TgLGSlo^)qQ{ӎr=2$W{_9q$x.ua 3rMcdwnVRJI4Izj}::eJ!* 9\XG3Ǒ}4(JNZrHtǔqw7Po6pط+}wwX]#ix$X.-IHݝ{sS"7uFUhp5 %5tS min U?HT.puBŸw}lS]6ʛ"7yкPckJCZ/?{ ~b.R2C[~a $&R)Pljq\k-,Odf;Wُtl~lp쇼;]iXmۿ; [,wq82 yzgPv']*kIܻwoo^wwՎ4lk+\=W)eznCٖ[oq3FE|$LyC~D}W9Je%(PrS/֯T׺bڻ%;{k2vg%s|ΰ URKxQ:/_gncciMvxvU菸v+ukw H>V'?ɥ ŕ^[kț/3kVRP"us,9!vwmܼɗ UM[kϿ5v&uxtW>76 ;g~٥ ^; foܮ{C/lfK5{A1H$YV{UTT~OC߼yIEМJt!~w֚eiH3"Ts&iW-eSJ򎉱nr;ø=뭴sZ4~y)  ggJ|{ӿQ->㻶wtp;F޽*%$qKkos,Ip we>fŬ H\*2Z@*HvhW-ڵJTSL|ԒJE•fHNTi֞ǧ?ǥWn^w=ϲ޻n٤m]ݭ[Fd,4ȣSw?$)JΕ#_}+L8@PrMsX TFW־{|;kw?K}u>峔[%լJw aw  #{om;gdHmYѪYA&w Vi]d]cHV5T?}pcq(;./tZS8{^nD7q~km I E̽Xԣ :N$\ynm{]z2oj\[.wdTGl:𽾹)ߑ (ҹkǟ6S|T%kM(Md?I7mzuޮpʑ;][_x_%m2Geau~Tq EY[;|ev ݡ~}%]X]f_{EHĨ4Ň4LC 02>Fq3=>oO iLmfn)V2I5!^! ObIkokC7o.Z^n.2MG#~][GnC]5hZM!ՙwn5ܫ26'aW/Đƹ@ E?QnmٽrܷA#3#P1Uxc`Cp'ʳQ!Zc4:b_BJI{TP2iqۓm0iڞ;ssj$^O$L~U5[LJ,r^2@i]UdJPi9.c mi˕Ijw RX=Ķmk5Vgka3+$N+>mXHv^q܌JI;]Z5NurҢmӑ鬼knjuޭgR;߾wKmy/(÷m[%  A~ amlm{ eFH DVO0*=Eć&cfwTa)Թ'\WHTjۻ;bmbݮ,Hc S.7kE -O*k>rQ݁ǫjNe[[F{KllVn=QnӪIZHՂ,c?J .KiLRkw$~bI]2x}8YP'.#rlsc$1ضu1#6` fȫPuj=J.*ٌoy~}y/grdM22N$lj㌣yJ"'Kw]"GKU(ӨÔ-@v{q=w[U݌O= bۻ7-*Y$[dsix *1F>/G=~u6m]wMs+kckninV$В1$z¯(w!j?s\@jfIJДq(XORuYQQn}>N6gȟ7^ُqS7p_l{nI$k*1Koc1:ۧVH[ldnRJT:nZ0їi+\r+-yJQZ!ITWO35I5Ŝ2?g֛x7˞Q[[ƻ&9 ju4 T\ݫZw6pXeRmX9"f \"B, ;9|!M8 rXK.[vˍp` .jӌ uSRUcX;8Y;On7/D??'@O?S4ԕ0'Z yt[;ti |䗩mTjKuzwMe-մt[-̰|$qt$[]m! *ve eWKi mbsB8sm[gד(82W"vF/Y7=﹭vwb!eݮ@ۚ 5鼊$ltfhݞzov۾YoͲ/- {Kp.׹V&8Z L!vܼrk2G$"Q:޵n7кAI'1,x쟪mm}FכO/6д6uۯw wIYES J~ּ͛[o˴ukr.6EX`JK=n Ѝ'ӞX]%u!m%Fe5JǢi:˩r8ۈ9wT*tug^nْ׸-{e=v {g;@d,r~C5>>v w[w_SϵKF7-"On[+)PZ\,%D e 'ޟF:^aJR9%DZ*ubfKiT~^'W~˷\n6>սՒ,nܜ֑$鲥Y&޳EvgaOz {s4k7]ڲomWgisɸ4P,MRh*0ʻ/9mԄ&d2ĨL'Wk{˕^ڼP6d<J  43H$eH{+tm_S6Q ӭ+Bo7,Xx I Ҭ#dV}Avԯfz M/h{ꍝPhiI-$8h0Lo3vM Zb4GnpjOPeJNjfg/KGHN/i-M,02ʒDRTJ߻T>=D׺ݶK^ͪqsu$k% VgPrw~.}({˼6N[K=Nfm}I:Oopv!&tIzY c 龞Ӑo9*i[!(qaER3S(*B(Deo]iWВP:I i)s(𨒅DkHڻ;CN7ٷ7ù7w{&KIb۶.&K[H-w_Qo{_nٓej׷7{}m,N;鴻~׿np*Cojk*h5/nnE qO̸Sa -*JBm("ߦYzv-:ï[WܭR~Uk`D). bf7}=vegոݯsy/tscv]׷m޶+B,˓Gl>=^}RT*[p`~YvmczBǺ սV7Hjx% k$nɗ%"s1wmԦ.ۿh((2/%<ĦdƮ{=<}>'OSl{&tvBh[;F Ijr=o;}Tݽ-|Q;iݧq.}Y.-lBk[٬2Zs-zݱmbdn,Pä-(3QRC*Rb}[{--m8|w* Kj)Wj¦$";BZ.Oa];m۲-nݿyd.-qb{v>Gd} zNc'wI; nORIs{n>!^鿷vtwfV ڵM&nvXX[ie)*d%YRʹQI@IukmQc *+qZu J159hTԖ [7[ ;]ծܥ;ȇ{gP`Bo-/"8cxؗi7]\>ۖgwmwz]6Nݷwov͎)íb)Nk7**ImIx6<-JʅĂDV,1jll6%Ŕ%YFpAHI Yba;ml\l>wv]d=PI @*Lhŝ]z%D^vo-͐٥õ+-Dz7ܯ 3`E HG^_pIB9TKVV@'YCK_Az(nYdXyRcƢDSJsmv;l1nI}nVwV۵%dMJ$yƦzvǫHlW[Wg~v裺'k׽/qMgk.Xc]TshR"&6׬up`lJ[k.H hft4~>7 H+R)@$!$L!8>lZ/^Ym^~ck=se3n&Z{biв ~̓i~`de(#rLO(Y Q\raG5'.pڔ]I\'%BED|'R;g}i6MovO2^[GC=ӹԖ.p^?پwfoW}^volvvfk s&I巺f %& E/av㭋7VPR2x 3+RTm՞ա]-Jɘ )&DeHPn$@.mvگ;{;O47qz9JC4]<Ђ\f ^wui˺l;MðoOoz!v;7qȾog;u mRDEby'ԟv)-n!RɂTN\@ptMWM1ټw`'*Tue(oB0GyZFh$D0Nn6Xw_ؘu^+!Nc2,}[׼Ŗ>% mwh']ښpDyU:X6//߷m2֌9S^q)b_-DE-TDT$evuˈa{o- omҋݪ:#vå*U*`=;ܹd-IQ Nl>Yar~zdE 3q9$Ar92 [^[@^ȡY*#{ Fh(5!Hq*SNO Um*S2RPʌTo D 9aK]5Wjq E,3G𒣕3Q T"5o4,\ *2GS dq@/٩VKe>Nd0(R,hA7H81Jfa^@-(iTObS* cTjCC*B5Rx*`#Uρ? LH퍉`a(1qa5T:ɢsO.qJ wa!9FdwA%H^D~F~(Rp#5R Q`hG<00q"6?G#?o#,?2x#|9 `( 0` (T!݈XQI,Āxuih㡦JʑJ;Yi 7dI&RI !/Rv(9.eRSrTפNL4Tuwr6lK1JPIIޞRM%-ŁYLȚu!j1Hn5 ?R$!Lꭥ1/~H} C-W6o1ɞ^QYJ BD=b c~f4 0F ݌J2\=bbT <0oL\n Ӄ5} Z,_1HRpbd4H)݈;l s:W:TWٌJQ $JuL|7R2D2cJ2-ƞPw8 c6p4xmA^3'(`291'dOu,1lk`8 yeeGma9/8xqj|J1 1aiS4J^1VtW%ξnZg-{qAHx '/Z f~_\&R.e+_Jxҿ/8rr5c1td4ߍ<*%/:MtP͍|9 ϛ|c)я/ q ky Z(iG?~ $Oi[>}A7H2uTg5(*a^0c?NstԱ9xLe#1XejAxC,b< 1FuO;$#WmY~b:G)ZW!A~xČpU7Qn{2E8fڧ:ݦ+#Y8m":k<LI&0'G)OݍBRS8TK TeW8D'mceזX (IiΣ!!dmDaJ%EKL3HRb?Z߅R TxN=/ፓ/Q8St{: PT{o9t3bJ5ҙ1qdL-[OOT.8>gO*Sƥ &5zyn YE@Eyƪ*P2B@ ˷ۻEs'aGbX-b+W1(cY`qQRQAZÐy8CuUiRی%9C@9Tug>s5Y ^ ņ`XP%c} I!-b>5nیS ` ưb= U<鍱]`IN39%38$ELb WK 3 ʘ0N 3_mOۍ:TLkIB.(VTV Ss1L.f6!ʢN"*=Ʃ32R^+*d}h|m81L*+o12drxHP,M)3>1Zp1_:VRŞt<pD73c-q8#),jtxP׎2D9O0{<*kϞ4R T-Xb< qI1p}ʮb߷Ʀb1+Џ}h8fR81n1 "/g61eF~~11Q, kמg ,c ]˝kN BiC1D]Fc '(E ,A*(VS R xqQ1L`J0cX 0V0cAn80L150e`0A`( PAa0(5<#0`0   1p1D`#0rAAS T Dro0bڂ 2PS i8 1DX *6jYH0cx WJSlH0b^>j=I}Upbf#)*11i:+ㄉ.{u '0 1m`*\~YA̘rZ~g1Yrn ~X6 A? d#Çɐ\b73`ŹyjRxm5 �` WaJL#>nRdU5n?f=X1̜%)F2}Inθ5 }~:#1B}}qԘ1L0`   Ig3`  SLυ3 2|rW@^uVibOB Mϯ4De$!#OR~J۽'ǽ/|}\lmYo7-{fŠU_:~gŃ,SxMKu٬4K"m[ou[۝9&EeqAiRp%%oDk/X=cOO{/Veus7k a$ӵ7 [މݲPqwZ=C{LZZfWpw5{zag۱.w(MmfΆKՙ*d9*xk+l6ʕgr(pkE5}Ce.iԊeS{s"e7uv{y$K}im{]kY8d n:1" Tnz[qK mn.=H#ۭd菲{u {il$m٢ Ż]\vm ;[=Jzܗ쬻cݻ^ v;vn{{Vv Xd e5S΋/NmZ͋j]՚x-^dd RRs3dkI\݃i\Dž 9HܢfR)NS}j{w`}3]q/J779(o^ϳ[O^)pw&x#,Q#./m;=q OL6/N=%{zFӧhYOmm{ỷ$5zOɴnK .ʝ~ej /)hs7AΜ?r?pib R\ ̔ I^H~OA=UϸX;mV%-7nV.L#[>ݡ?P}ڟJvާDzuuvi[w=𽿺Me^[xUf@ɦ .on+tVsTsXQ %(RHɱzl=DoilJ vjB.,"I9#~=>ߨ㴿NWa-oz}gzwb)D[~O4,: A}F7N㳾jfӼ6}}t:_nioۂNPZXi4e}K8[ڿn57THmA Hn<E'6y#b:zN}X~@2~@TJ{~= ϳ;rҿN=zӰ߫›~a-ขA$mTwٷXQwWM{Ӻ Fr~۲^m wKD-DEUmc],G@VCIP<'4d<4Fi)Y8+F=mFe9%h֙QI$_?l5vd>o}ڝw63oޢvsid39-"d^lz5ۛom}koo]Wu iCgk:G:!1uzE/FiSu*KhWJmzed%C1IAZgT)@I2O51,#R笠{9c߾ ^w^WBNg0 &9#tn( levM6OnS'rYXvgYz@l;cݴowݥMXYaWг1B VQZctU)١7’u4|aFI'tJ;.o\vZ*JT ~j4'6\*TS"pB׫=~ .~!;ۿ'bW;s;=fR筶VYXHwP}beý;+e;zvkmeݧ5ԗl 4*(ooQEB3g VwJr #|Yѝ~t:%_d HnIf/ӯYޙwa;/lw.}=s{RH<$dj'KL7N s[ .6=Qa2 d"Pc{Y6iZ)[([لHoEACoJ*y*ionpdڮ]%ۤw Fg6bMI;-eCƒr!`Kq޼Wr 4eػݼKK;nmh6}_5uu@^%e7!,uC*te$xL+fF9&>X9)P Js]EB}yv[=yz" ttuZde#IQMCRc` ]۷OSnp[Z,.bzp,D"+y,͸mڶYv"P9Y_]lѓVBDIX1Ǣݯݛ䞗[w]vݲll){߻^HwkFfFWЌLyސR?eO}Wm}m۵m>moro/-v8Ye&fެ} Ty)*oQL(y?=WڷSl\e(dS2 QXh'7cۧd}^w ۿѶۛFx78Agcc$L:l: }޷ hǸf;=r崅64HU33MoX}n-(4GArukoKk 'T,V&#}Y_~۴{c>?M}=nw뵯g}Igo4I"AXq.;^ph͝Њou% B*hԣjG1N-H%9e A#.2 [N$p ]_l[mnDV6҇ƺ{ء2&>^l[|.&d U|NW]Pse3eRBH V9kRSjeHwkXE6餏7V#nWtZWGl?knvm]}m-o7I-֖ K\ 3Y\z%:hmۋZD <&c?{B]E $TMxf)z+N?~Kߛ{}sn]}{ŴKZf,byn]zl$*Dr.v;6[{mltk+[GkѕK#xK\]Z߭01]߂[s:~uҗIVi&fVQw.ط'n͹Y ;[a]Ie[=(' h2>.ܽ;#&mz˴׳۞ݽeMݸZ?Cm緆zsFع6N4۫h<9i'*`,&yU[?j.lmL2KG6U@Z&Bmߵ}ٻ?znͷ?{g`ܝub6yFۮm\NXɬЯF좒oZ(͗N7Yq.(X31OաJS *ḝ"Ӌs˲oYQmFm,7wpk#f ƪ4P]lv20ɒ4pFCah€Sd; C)Nw-!EA6^?ŎԈzl㷻wbIny6?qk<#7Nl,q)Zr:4,Bpjߋ~UG!w/ܸ)ÂR?ݬkԿS{ VH[%+i#Z4ie 3jujU]gM;f4AVLJelk]Q;{1<{2}*R#m]>V;}@ܽUbH3>Z9%PP|06UP[mA/OpWAR8aRUAOv6֡A+/„{rYS4o"i];3nmZ SUlbw.vR4j$b+ |U|'Tl)jP߄-lٯZcw6Tܻbh:H'Re1s+Iw;K[jSExdɶq8@P8) 8 ϶1.cEHmI-0GUtu~U\ʹ øBVAҰC6W\ &RW%,6+&yO~0IBKmr.\Rw =hu{&- )H2iY0≮YhhceTF*Z6]+ OVR0nIJ-ngioZh-;Lq4VYJыV%t5E- pfae HQ ~1۸o/uٶh" BL*pw!Cg[ ](1-C@Yȩ.˔nN$ Zs6R?4v[w_Cr6͎o2^IM35XFM<OnUUuܚvaē: &V5ғ)*Hp3²<{>gɷn޻0wxlRͿ\lQ2L"sJSaAͶuڢo2{k$R0*,L9W R)W ΝDp;:(.\aiy ;pCU=}ݻ եۦږ㺴K)4LeJ8}V^Mk9{/nwݮH]u{iVot!ad -ԫ=T8TOr^WͫPSRć$L2|;wto^כW/oGwm[|uAgݿ k ENŒĺa][B[o )cj8LTQ9WႦP cS?|#@ =f{tRKTمe+/̔]J5sȽqdj-\܁ 1ݲV# Lm1n%eqRr{gxG- mMk϶s@+XDz0WR3e"[ڛa-7 uרh!k+aRřcE% Hs#”d3P$'2HTç]m+,rx o9yv{^mmig߶ڮܥWXĎITYl-%M [l2bDI'tZݶ$xD3.X9F xHR 孅zU읞p4V$i%Yt""-PSӹ;c}=n{{,.qc6&pC9\"$E~=ՕߵyCBS晆^q{k{qm=۝ 9mOVR6B}kϱGlXgw @CXrh*]8В$umtܩm:Nj _".-n'ؽFv{'o[HK LhH𳶕`Ǫgs{ץݓsڮe{^!Yl6"I_2őBө1.=n$!+ZTãua˔62Kߗٱg7=Rh,!qXE^s{m k>[Q$ѐXd>+ {V{$u%ަb 8@kR5H[%6ϋ×6d£d$Z<1SW]}y]uطDFHgެp,qNO/~WqKq&62mWQYڤd5tİS,A2HdA2wN">@% s2Ny˕Nڹl.s6od˹v܎{kfۜ٨(+tcxbw;b=]7[pZ:2L4ݕUh}A% \L8$ RdEĔ ˦6F}nq]-%koq{W"I5ښ6Lm $(~4Em۝{=-z/<]ZI՞P,lCO#z/,.k"c.`rJQsq?0zSvda9Ω#}-i~oߩPX\upXZ<[TRXnS_Fo-L$3X~w6]ݽ]߱go=Fޣ=ow7dUcVdG 3}abt1<):A JR Ifn-&m$ $,ICA faogvlo~}e&̻?w eoݷwp"sZ3KNCG͓;;_E{bϷ6kKe@IgkӶo6F)BL5Z\%iÕ%jJJ3NL5s[ri3|JM5(Fp>M6Y7k.M;3f^{]N5VW+)L3I !Crzw/awe_Ӈߝ>l6TLoܑ\oS[L;/[nbIKc:XM B[_qģ)JFRTJMN֭=C~oʆ[\P'2&A*@ZBHͺf^esdݶM˵DL}oZ]m[66X?@&Ev5uzWwvw{o۽߬]ݭklIewXS2[Dݸ_o5iR*$rPwጱKiڎrHS&ꐕ+2T4$d""zuvݧjoTl=mvmV{KrfEL*% Zh}4}-ޡorOh}h_aۻrdz{{>iMXĢuH^9ڄ,$MJimj喭|U-K+VuM3yM I!@5fɤo4Г rT:pQ?JͩǬ=A[g;mfovޅo7یrn)nFkITK/ļzg>~;6I{\{w=< cov$Z/M![Ԟ'cc44ծͷD֐SeTI(JT p]4wݵK(ƙeBrך`)RȀZ%]!{enMs[nWg=n6>{[ydk"4s#Y7u/^[ntiݖwܻiqپvnތ {v=c|4m!4],oiu= [fm)%%*RR%U4EYz޿zMd6%gAyҐyĖmi*o^nG˶tW}ۓmW7foY=,w,fv꬚;WqigseӧGzcۛٛuly-wϥnvۮϷ$|ŭʼ3+keiߚʬ[a0r)H2zͫW܊ W2p()*R$ ͨݿ4ԿNWfM=ô7KmD7kXmtݓqhc]K&@1/]okn}֮v~wOzpGl]=a5Hmv6wk`EYkڮ+[)IYTT;2r I L, άS֣ͼ@\2V IQ&AI3lnzܾmn{mpP~L<-EId&ZRgWnnW7є6dۺP=/ ఞK?kv嵗Ϸ-op!&Uxm Y옻U|PXP)PqR95RX&+;}@4H)ΥK,([srv\CRYAo4քD+gq$R"6!HgvgOU=CWl{8GӿD;dhޮv o1]I%C+WjkcYaLel-(A@[(R (3L2k7ff 1縥#2*-iRR>+Jnv(;/vs\7V׊]!s\QZާwqfv/^D=n]q%_cط L07cU {zWWn̯.JCFTĤ hP S"S9/w7EjNI$R[Q0 iNK}ōþ6M٧(asY"˞ěo}B( Qݻ٭;co߿w lIomSK8r5R6L*VÍ4qYRTꗔ t ΝpvQZ+X +m.ENeL$I*3?qv]x۾IA}<ޛԗ3ȖIڛ ;uʴVnվk綏ѯHPIcs{~KIvpKMkXd{tVWŮ}pêmA e*HPH(3'))ge\'`KSiB IH"K2LdbsmͭezKfmMo(;yl. 榥m]fj8`=>Oڶlgumq@Ҧ)DyG.mÏ%AY< %$fHv?[\Ujz H9ʌ%a9JI H)J /oW7wԕmO:R^+=~vdww_cmm+qf`";)M) 5q\ӭ-uZ!C:JU/0q3IsO(X0/iS۶ CМRd$s$e5Zs khѵ5Ha$LjͻvwmZ^c,2kI(Y2d@dXkNZ֚ޅܱz8DҶJ9.iVu*:V[x9VIIEZj4ʒ2}08gȮ(E2AO`}/w+KhsT @b|%xy*Wm攔Z+ͻ})tc+U9iJ(X{BJV\qFdDOLS5O(4B2b$Qj + \VˈY`41!2H EJ[BM>̰ de  $0plc@HUvFpٖ҃\*ix`(j@qZT"cS"i+ %bO"Gcw3S3ˇ!XɜŠח|}I 3+@FDLǻʕ&ix`Gj*A`x0#2eSn#jrQ]z$Pa5׌%,fI<HAT9R3! ,kQp KI~HbrT$m4n %)W 1e岒4RI$ I eѬb_-]:d[̥~n_<-YKaS0HxV)YnUUCEJU 1pݼq "y 3{8ЄŸN1 c~l(+(s9SkS-A`41)1 A`/7t}jq0b#`0A A`#`q0`   0` XÞ6ČŸi A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A ANgqF.#h1LA f @1``8A0F`Z>b +JS#qY;,|ӏX%1}AeNxb1C` \d1U*Li^XU xלTxp@%b?2) pcr5 0`   0`   0`   0` #25g#tL~ EvZ'Ɵ PdNwXLkW;pAq#*}J `?Nc&3ÝG,i% 1?U~ǎ6_a `zq/p3/bܝf V *Jg^"\6|m4Oy GyIuJo8:Oۇa~1\b3) >ʵµ|8 sɍa f 'uj'/o:tȚCg]C̔Gpc"ΕΣ8C5ݫ Z^+0e]k/X)3v۶f3 o(6R3a1L oW.9o<9Cs,:3T9q"݌愼c3ĪIFҝ8l9*-pu:k_c`k=>ZPk͕0c9I$׀'X3QAEJ&cc Psxe- I3#>*B6ʑ@5H,(HlЄϛ\k|cSF2JӅG 237+2PB>YuW<˙38l \3:ƪd'0 Ijğ Jf7̵;1@V:{1jC2X0j'Ÿg3<)`3  Hs4O36^I t=c:,,>[ ?M*aHx|?hXurPgceI#Qb!OЩ%5 aY+R&cCŌı6yk9q )g2eBi?x2& ݨӾ WPP-2IwҐ[kˏ )A iG arI (c$V]`e<|X‡X,+A)qP@0k>cg7 \Tid187m%,`A8f2Qfi,n_n01_ _L9ԩ Z $a6Miև*aH<-Μk*oc@?gƋ q- W:r\b.hI0`52Lah,xGAy֔ϟ:sbbן&1uBO ۍۙSxe) 4ϔ3d$TxR<&2>` G1 8g1 !3nJ0"y?w2'# "~(1BF!G1&F,f0A*k`ȉ Z(\k9`91 }8`mUq>W|M\a\d +OwƠ&hp 1b΄fqx+ A(~l9XOɃGØ݃ 1E8f` <*G j8 ŘКËms7511qu+Jƾ@%X1ƤpAc\g 6Ac0cX 0c0AiuIypWF1{}q2#I$G`"*Uܚ(3ŇEӵm~:~YMD)MkZ@y2PJRT)D Ldd+>G޽qgL'Q.sݍ{d\ֶhufנ,-#҃/!^vV2)2~?Ëm X%EA!ߨLJnnT BRQ\BNFm(Q.$*c=f8c;_OlzW-vrn7@.΢ 7ӟI+qK>y׵NgڶtuB8q`DmӬDFAQ+/M7޸YoZSV̬yM r!!3If p]G^սL{ZQA%  Hem$L cԞo꧸Lg;w"K{Ygk춎ҷgqa,C2"vgma0% .s fxXjXP4|9V{=d)XqO1=P>މOI(ח[dKMGo^Ƿn7)ĩNтd{ *ڨ5ǭwol^}q J&Tr !\b;+HlwKY${ R0Ii x)*@VifH5|f}J9]C.ϱl]ngv{sv#V%UO3jlOa;[M(onho1鷖JI?sB3lW~.ZHvƎv}wݻy6m[Au{u7BHȏ-,ډ,,[ZVЦPZݼ͡UBtb9na m9le7Sn"Y!X-#ttrcA%vsV~ǡ?->Iݷ6{]epWp r۳4y3ht&i~ȕ73kI VuR(5{ \2G#4Ip mVR4'gL0?۰= cpfl[ﺻ2Q}ZGy&bC^-Vxbi5%:4rva 6޽g'zw-vv[N;vvvi;uZ}OVҴn-C!VD#ǟ)ķJ_җe`E+"Y%ejr%5H2~+ m.>ۺ7[MY,oNNٶ//L(kn-'HUtQ~ޤ=}}kaV?Hw׸vM-n)nA"N5O4KMZ}jp@r)a%Xϑ ʹ| mP]MP s:V I;ɜݝol^GK{mEU~}PetM;wyYHpXNεoFvV6޶n̓{ l7ޕo}q+fnNYcFܳjVzN+ӍJJen!jHm6C(YY[ ]S4M|kOmB- $dYQ2_R+ҿ٠{^_~l o$ɲv:-I<䰗;{/nwՏn]ڿOM_pk';1$ۏ{nIho; x,D)M4M+LsK:k.,!%eͩ&JBBE_mhL2ۭeǂrPP@ ) BTz}Ba쿤M۷Ϩ_lzUۛ{&i:3D,|[g>w<]v{\lsv{z_JOԗru-F-m%kTgkmsyyRtP/ֵjyIZ҇$qBR2gF{3b޽VK'n'uW=.ocN.ҍɥM<3[[ZZi@%JH#Npݯҝ^w6ߺ7t&/rwu9;YEG-eJEvo'&@< @@$@WԕVqhqOydʐBJpM$)HLT~޶}rnEggeoqm;ghIcObH]#][qDPK^>wwWӿ=ؽvצhw}w1sh$Rr=F8ov(Ϸ(E6pc ñb*OX7k {j,'ծܯS{+mcn,lYyui iz[[Ҙ_\/Up6B$!^ I>R:U˧^ZB@Ae V3^d2:M]k>?ck=``QoKZK VsimkQFa ,e=xw?ynm؝ݗnʹݻ~qysYgkE5rZޱoanKN!`*e^dS[YC)jqPe+=*S(wTM-^w?M}R]˺E߹tX[H,f*QX*qsQ7mK[2]{lZYPM ][L(Fk0%iJS6Tdi)LEҒ~m3nRsoIU9đ}ɷ~޺7=˶{y[lr7ѕ4<ݝAA{>ۧ|[{w&'b*lͩTKiIbRj%1tn>P Rs!=y搞Td$W/h^n+ 2ROJ+³;ȏv{{nط~%9 GմGatPn]vuf[rjܤ=j7x.T&ZJ 0lovnX3\JV3>_יI ؋d߫_T(M9a.3KwGkEWC=C=@ۦ^ۻ|7ݢ{&[H./4̪U,_2l~}&6]힞fai۽{]}y ؉,&^A}>7*^f[E'*АIG"IQRt4khZҒ@RJ$0gU{߭"?R;Z߸y-y-ϱ7ܰxekk/.lk^x^.wd}B^nFaܬdkh$RAMޟg嵛B."HxTL̷EK]K 8 D\B|Ir(Va^ }NowKlem},G{<1Lz%eE,#^v~v4Km3]k,ݧw]Wr̦TG܋i]e a]NOUSԉ-R$% f=2d"e*x *LSmI=Q}&zm߿/2Zv>a| lOwvXeXhU̴Tw ߻o֎Yz=[n76nr<{k=Din,'+NL6|:RQ=h5F^u6U涶Je-T? Sc^mOwvy};wfѳO\~zUe.c&gu!Hbsuf)EP镍]ݞ4z7`z;k]$Wdzpr{ͤOܵȲ *RuIN^zmj=v(~tR>y$(9jʐ +KԴb{vKAGMeDDҮ{cӱm{õ}Zar۶̓ԟC76޶9D%ItUcBf~߻ͼ%ϲC\!sa۞*O!29ܻ}k)'!͸%? #x 9}EܻԗWesf;-{/7Mb YX;ou'nChhv5w'uvl2]m䷷vP%49ѹhFn!!m3|ҙwӻbYAdFY\2Ǽm&oXaL'ˋO^]ZhmS&s?2*BޜyˣBO>buey/7xQo7K^ro n7QlDe[̫ZDVF\><0)nk9 FO@ H+-܍\2[tvl.w _V/->*Mql7/ xU| ПYBj@?彺C1V pN'9bi>1:ͤg[o*nl&T(dԄ( 3geeZ+BZܝM5$G*컘Aδþ>Q䍩 w;pooZ8_wl5ܩêa/oҪ5 «fܣT )ˇ=<7yH ȡ%.{˩H`7ѳFlBoRCm6i3O&8p~_˫U)쑉78[vR)E8𣀡$O*W/ÈY\ xSOdsok#5AvmV?`ͨ W6>n+gQ@Yށ)Ǐߍe`l(Ὺ,+$N;IPi"s=ޢcGֶ%fE9դ!nbI^f+kf3\(RFtj}kUtԒ8r^q${!*o^8[{hy!x=8^"Vm!hht6;]5ճ.z N"榼jeAǝ]J}R Gv؛_ܛds\̡t%YRp\ΊW"4G(; jަuIUWOWJy1o`hH"kT4<5- ) 7>n}˻;F%{J!dOi5Zpg>\#bk#(u/",i&V=ZF9%2,8I{--KPC"x6KD۶x{7I%&b.AUysa[뷕痩 /eΚuUhx9Tle.Q*kzb ٱWDIȖXo&;WdDP XRkJDۑ#tWlNc!y!SUԨhגepc}ع+$d~Qs5a}w{;M`{&KohK"f!d,t(} ,~p1m sOh4h@~!M{iP;/Hڷ-Z}QݴRA70|\H^o,R  /a{{f C2ӫ)m\Jk3q1.ȹ=6qqc=o0 yil=0,bVщJ4v6޽G_m>߸Q زzoDT4{le{ײ[=lKc6>bjWiV붢ù$- #/ tMUj:N懛Ik$f9%@IDop{}>w_ȏ{#~Xě^;%]֒k4 RYJN>zKȴMǹ{_l-np5qۮYh%D+_tS.2S#/1YB ZM 1;ztّI@ xHJRwOP{&nYo{۱d=at.%J(Ӝ/_P[ ]<& - U 2絏sԈcVۀ#).[PQH+3$O7̹CZ/+;R*Acw1Mn#,%5yHq$ww?_~޶׸}TmaNWϱn ֺ dpKm3Niݫ.H3#Z|k2J L$@Vw_r!T.RtЕ 8P$ !"6wۯtmlvߣoxEk=gݽܛ\͸tW l%e9Mm۽W?W=Wg?l7m~67^==觷mc3C<^;xГ.?CuKYPB !dR`@H$d%[7z&jZ3 ( 'sB' ${ {ޯgyoM=ذ[nmy3\-+@"WDtOU-gR6im}/tk`{dygxjEH-szln0㍭Y]m X|̰T+sz]U+NR2)G)N3Œ_L>o6r}\X.~mE4u=%U%^XsY51jh߻{q/MYwW;.Px[Qcmi). |ubO8m_C)UZRCu-%#@K(ITukݶݾd( .h B$SsKoOaiv?uv'fvcϴUӹѳ&ݷoF%sZ\v~3n<;GrFv7}uܞv磝ڒnN-\ tu RT[)ZRkIXHԶ(H1]BX>[qR -)ZL̠'$yg;M,w[϶j㺻dvovۻBX+J?S,E]}RѿL~ gnKMv, &{hRՒIci`.NͶoqjPmj)J4ʯII ! NKUu+fŝų+0SK 4'2ADAE* <i=ǣ;[ڳ-7 ]sovp(ΫL?C[=kK9v۾~}nleI6vK=݄oZKqн>z[KH JmJG2E JZqyZM(w6u-).jRRRjP2U3OH{k1o\;oNiomokö,%ՕC,mt?@dtǭz=xzq=w;ɶ}7Gv˱V{gi;kX^ue{h4Hځ 64FtvTޡ)^d~KQ Z* aa$%(}1:u-bmXZiC[)Y& PSK )No2NGkߧvl[ mם^o-:w3Kk2ʬtzK};z߰|`zcꧢ_Q@nvtl;y[]bEj^4R_-+i$=)x+G.~W[ΦVbU>Xȑ)+&JND6\Ԛ6l^:_ Tڋ$JVV~\gOOO׵ib{q/'OKvkԹnpmݹῸ7 mkhEFK6cu/O[szS9{6M;Vo;gN;˛qhv(cZ2ۺIZo"36d%Df!$I0ԚK(}i\ԙ4f 2P#0)P>c}w|ݫz{23o.uoemw-i2wn.Ye)#ULRW=wm}u}h\]߳#{YdK]fu(I7o<-r*C'¢WЄ)NYCSN.5 C,Z֔+t$8}Ep%_8&A"KyI˽=B;d=pv]n޳Ynh|m{XFi^vϭA===M/ɶM=I2o.Z+ :+?Vս3]TqJs6*C(ˑɟO7\7zA/42N2B̉JB\8RȷO.}a#=ǰ4{r)m߻$ytɨ9f $ z]e?~{mu[۱{aNyr]Emmi,l\nownmvjչ:ivm4Q,,;pEM''Ε%*֯ -$_nhQbō˭82l<RNKyAJW3Foqc!n{ fD2[:'O{l=ޛѹIٽ-;r^m[f52f"ҵn5 RIRԴ!iRm'¬PΫ]7U ޭIbRfh)(h79K*3 XvTvo/qwWۻ ƗN־ f%Sӈn|_;;:/Lkam?羽//ƗeXɴGVnBF.?)SC8BfA +*&UZH*ViE֖]EʳjCZ&@[R* ­>Mp{M6ӱ+9n [\3wWKuUyrzZgP~zݷLo~6E)=SXnr!g 4?S8Px|$&`xFR2sSE mkVՖuπ& )%F@(:$(QBd*Y/rImvnQ1/|m.'\miՆ=HD`_]s_?N>nݓٝ^K?z^`phro׶[l6mvy%bfSjTaˋ֕弤 LHJI3ꚝC2JXtL|.KLd埉 J]wh h}|o.bmWt ^, *-Vzk,›o`=7q}}\wGtp4u5svl`#}xAegN"V;^5rwL&Oy`JaN@BI 4놔`t yBqoe;!$i%I kVhʅiEʌْ@B-%+wPi˝Pۮ(N+q*)@AumӸ7+R__$mYj@Kɴwcs]ڝvw}ޏg5-/8%\4HG11m_"6!W@&\JJHs0"y.%yh%aiP!cTT( {l0 f+Imөxt#R:ur-#dY%R!5M/hT\F!'[hBITeØ F"DSv#X[{k ,-%}@IE(WSEuGQfV,[w*DSU@nc2\$H0I') mIҐFI@՛.V.#&ڕz`U83*f3hI=DճHvVo2t1󡩍Tdf01z|dVtvnHQq iU )#loRijo#Ӝ#'8p CD hoV[6"WEKs5P @$f28#`x x(3p+ 4S2g2;#b׀_v4L b "}n3:F*X1g>xcL0Fb  j|N1^gIc83*1n1fg5``y1L1Q{A`A`-cB% 0`   x`Ax 0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`  ȩrưV ]#|j dǘ<~)ư`=߱ ז11 2{,b2&E 1 V8#2 29ayAxgJc18V SpF8A5ưb/`'ʐbN\ pAQ @ ?j`W|<>l+ Aq   0`   0`   0`   Vr<`)ӃW B@jqF1LJ5>c;2b&^34jb9<%+o`#a5 ^}F50DڰbW+tg}q݌`~sn%0S)%-:ۍdSn1jkSA9cC%&';o|#;riUHmM:Œ'3`S#\_- #;)KcdI6Ӎx=o~1A Hj@vy 6IQ3L$ZJB^3+P *?cg#is92*x7Ÿ xNjm Ff}q&D1NDtÀ#H2$L۳i۞C>_`BvpT? (CCœF(*n۔Hb<aRZqr+*fI? X2m/Z6|RNl5A3!A<(G!S55_~g(1q4V  T'6Rc SL" )\QxsȜW()9fNPbRڈR2XnP.T,IMOqpӁis1zq P3t5gkS-%96JidžBAm91xS\YV3@ 3+" žpOÔʑ+&)|,hL`4,JQi|+Њ2IJB’ Ï,L0S..W04jxW39Xv3MϔㇰAjx*cƠ!] / CW/ xҥ~ \)xeZqMѐ@ Ou0FjL ŅTxQyA\ 3?/ ]aUy`430iCr YS\j}+ 30ԅ7iO0k(pQf|eiA~w c|#81y'^c?卼SkZ|pۇ1\*}~m44a-9ƪ3Lp`L>9c 5fA>~1_1!Z?w,ͫ>=4CaaH1QfL6G* HU>Z Z|uTnaϐ+>m1mrr;`SB3g|(!ӓȐwwAG03r8iJ7nG0|$ 5ĘCmZ+7q|NuqZ9S5a+ƤQyx}pP* X8gOe?k nIr_o<ck_uT:q:{3YTNB XA (Zʹq5$! ΙfGʒfH1pkr<38$Lc ǐ2fyNeM(uA A\xYVqH #LY)9ֿe1 '_nS 0b~?,jb;0`'0`'1 0` `0A A5A+`0A AA Aa80A A`qdq _aX0` Ȃ T nXq  0` @ (ʳ|r@xpϏ(v7R$ݷlmp` ˗ᄒ)^YNw@ۇ %ğ)[{c J TٌI_Wŕ\5 ͼ{0`-N?>o(;jF Š(βt۪pJA/r(H ƥ$g W63! 0`   0n6V1)V PU) !rQ<@%{Ko|`k,6$Z~%d<*IjdVBFǖ#ȃ 7Rp9\!3*B+ N@D$iV ^,&"T f%$333$ dex oNo*NU^- VwIJfH!A)Ndhϫ_wnk}4zY։KC>n=u ;rDXy(ad_{$[Ard-,_Ӵ:QDkε.|ۊSo:X*R2@ W.[:9=ω;>fB ITa$EtAt0d& Ao X-4TGKmX~>u{ao,9jFw{n{w-i'52Q,Wkgqy'YJ3 c"#ه.7a4$xJ@^[9 6[Q{+=T7ޑFΡe;/ŝ5(o߮&]k5=W*ReY'2Um*K-elQqj?妵*9gwV[ɇ֏[/2R[؝ϧ[g˷=$W]KknRKI9%xԤ'>tۂW47;wx-7ddAm70n`U3%+hZ%mY2  1I$ehXciYg?>׷6հٷ87 VԞp3w?<}WEHF$W%W5`N$IyGGp:29S8hZSmlIy!QRT WCGg[ɸqѰ\[Se}qU-,&l 3O5)2qIP'̎CqjߒHSU'T?ĞrVxg޳d㿷N"fl-v%7^6hՊ(iC_Q?Ohݫw۟oԗdmwVg^\X]U-RF0A,]Khz5eܡZ0'-[ H RԔLBdRRz3W:ަ݅tֵ! D4.V :ј{\"~}1n{;vNn[>}9 ywe%tm0䇺6_b]ɰvOݷۛoԛblw72VՅk+끦ALISUҭV\8 Isf_Bӝ L yrjv_?ǮJ*BKdOE)DL{="븻_i /ul=ۻvYSFfOU~nKMԯQ}*޻{ҫH O_Ź칭7QvihqISz}6;]mݳ}ٝݷy{*,)c 0\7l#G#,\2#j,:WJ0JPIZ%Rd"0R2=_PIխN8R1A_ ))08;U߸{/{Ӿ{ۻ;o{6 [%mfXm; IP$Wxv_+n^nRVW۞wkSkͷ,6 Wkl 1%VA$UAC6ȳјIinM0,g}ߘ3Q|2>cz1%,i6H'ZJ0IR {v'}=>3w-,; Q{t5;}m _w߷e5HM0r{\#nݴ(].|߬7>+ݦ[N^E7N罎p8 cI.΄}Э*Zw}XPNp(9B%DuJկ=!nׅ/\d!k̔R)*0(oGv;һͫ+^coj-Snki-D#E hn*dT[a_>lKm;nwlp\CqڡN=]k}qha)IPu*Iy)P\0=s}9^'}];NߴC7{ j1\^>űF]z"rH G\glaw'inۅeౌ][o#\JJ %jkSkgPSʗ-u9w%jY&_ *9T) N1ޯm{ϥ>vm[wownݼhv{Ϲ.KlVU+.''s,o]_RhҨ?ܒyiXdt6B{YSZCi $Ȁ\~дxGm8nS#-,`-c!bD8[̌ߴ]ݔ,ێ`Ie9X`T 3DO0ÿ©+]. F ./TIlv]9-1gwqf";Ha\̭XT }miY9f&pTBg*w$qM< RӾ E P~7hOٷ$K5f{FE+yםm{ll-~/֏im,"Z5 %@㇏B= DF2R)kàAUL=Lxj%Dmtw^ݖ碏-|!mg0,M1%ڒ#12ƎmӜmJ⑏`dBVf=mvV׏k&QqZm%'Ffy*y3^ѕ8 H$*?"t4÷R2 xf'Ǘt&RQRi/.轫:DZGryt/#MƐ5SWºqM'bXmMyuTpnu8I XZ^QBU0C`/RаtKom!ȫ"yCi5ŲXa%LȎ `MF9زs ;G2t<_WWRll#"GSj*%?#I$.E/g%lRI<;zݧU( LS2("u8Dj[w#g76Rok*=*".#n氖DͺXJś$3:VW^UiF_B+ϔ.gc1=\aV&>.2&9om;)%(ٶM}$F)^F:c|˜mNg"9nn/@s2ZԐk:$N\.U).2$uVP{3{B.m&k%]bDdWRM*=lF{M2%D$#<.2Qwp6vUBfAPkܹ+RRT_R廋qP3*G ;k70vZEAQt$*Ǝ*DGqN߶$w{:hKOc׉Fh+icol!rf&}c}v)XXdQ?~vw7m7k=[wm\M um}$9;/b޶=Eq[˸ 0*̬*x+9?w<^wwvhG/ޱm{WssPK-(qm$;ˤ5bU;jZ^Eů0TdB$S̀NS TMZCHK2T-E%3()@| KU+?P3l;{?}7w!Kylntt֣zqBJ[謹V{v[h{ S{;gd ]aim2ܩ=0Yx[GOJZf9\ JHWs-3.&dbŅݮr,Hq 2I!~ Nڝb{ ;),Es_x57Myl):X2N=^;]Z};owo{pwdOorvgHv߽{mkE N×֘tgAMEs- @48nmiaWh[RR$_X) AT˔Sz;di\Al <۳GWvl\t%iJc;ON=}OSM㴏;.[O7w+ ;ӷwri7;}eF#4ܡ4{%R %P BR%9mnAR^_Z0_Nt|3"Jko~YlQ]sewk4v|z+dm/ז(#;+FHգeXV?ȟ+^-{oԃwڻEWn+Z\ޮ_'Y]ƌ%qjCCΥI_威!ʤWL#,Dӽ<ۮ EK (Hd#&r ʬ.k^}ױ;ՏL'N8{kM1^[kC=bcIUCF>vw_]`_xsS~[kOq7pq3~ٹ]ټU>oQIS*H[ΠBJsh+ @NT.SVB-G}r7 ~16/-T) I9Lf.)Fm^`NF뗡[7t$/RNg$gvnF2u%P>]Ƕ~);M{}G_XP~{`niOOAmn6~-؛VXoc 5nBZIMJJd*G%'ZD鷓u>nr8iBQҖ‰(2h/F}'wR;{GI=swwu粵݌Pr&WҖ],F} ޡn?y^nI]w^Ygԍum1F !Y52T,RJRS"3ȑ<%Inmۿ2)[ĐRDpJ&~w= n۰8lm0m^-͏^4%P!3ӛϣ+}㲶mԟL7JlwK[]etS|ͬ#)5{uq@ '9 š XzOZUcwf!JmiD5R|@RR;cKo^0mznf y٠Ŷ*bHeҩD$GMaW~vO{zU3ow\]olwh]K޽swM]e4suM$}~ZS:ա(@? Y$DHTL߰E΃|MHQ!D, f!!IPS۽^wNٱm1ǹ-ֻ9㾉路vkN hfOӷNY_{l]ݙJ63Iml6GoަٶۘX'QU"_#ϵCiB+c0PRHQI34‰w\+PJIa:-BE*!D$2J7wV]_5ی^l|VR%ĆDZ_Dby zku)#SiR~RN^l}z~KkyرvDVz[sni%#fnXc]]w:&5-jYB)Ug.-De⤅SҾҗxYRRiO(ĺҟ p8D՘K.{kXwMW~ o|ktLS.R'_j\z/ptռYl߲[v}6W66Ao}g;,<%藈#بjcEվ7RlRj)5SJ'ILTw]ѯܸi.%iHKeIH Ȳ%SB4h>~9vmnI9톕,GU]Z+Kùwԭv~-r6o暈+KmstLŭ寕, qezhNbBВ3jB3|)/ZJBB&AJFgZU96Rͼ vƈ!XZzPҙpvpWwkw#bK+cr V5%R+!*9ջ7&vP^DBIǜFlL!e )+r 1 9Ib`ȡeaUaįO/N}߂a-c~ڣQo[|-yhA*ZU톓NK [YBХ%fW2+I,мҶip2 I@RPdPPWc$!咪2e̪+79<)i);ycsO:tsm.c`UUh@@AQ]6q6J24Vf4|3d˞in /ްS.!Iĉe'343jKGƋRxaҵE!8MSM7$aH`V0mmcY>c2CQ$m5|6ݥM>J&!Dy`cwLW%Q. i$'Lww&pk4 (xsbҋ eySNTR XV!+$HO4fdIȃ 'QDfԘfjƪio\ R(BQ!3RRdRgI*)ANHB!2=*< ;wr|[o4hN\hIP*9S^$%81xrC"(U%J$:Pxa`ꔂI I *BqwC ӣ \s8*$F\ZjVF:ul"[W4SKܥA!JFt7A\β11@ Z 7ȹq^AʅJ\S|hGPNYWcLD*R;#a.fP&~̰JT$a1 YLK-& VP`rp9N *E g?0FyA &p`X01L0` \yr&Qwq0A+A` WX#8A`A#߂21b#b3(1J}sT Sk 0`  7l!% [Ɛ`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A A`0A Ab9cXXe(1~^5\+L' f1)181\ M2}+ Upbc|qpbf557FSbN353O1H <>ጌc L?|^>l>ƒ3Ԟc8m32N0`p@*8= PHP)jMN3*ƹYX1P}d(K ^)Z_}>ctQ" Zxg㟾&h+1hDV   0`   0`   0`   Jc <~8Ұ1.0wstX #nA2l' Pi"w fqId S 8c#,`Pp J V}`Afbm+Pgy`!!^PbR'!)#ΜV5(2Zq3b'-ADֵʜqE!C$ :!Q9sʹrî_͗ tjٞaA WFg!e08+ Z։ @M(>^>ьS/6ERxc3ۑΕjxO:&vY!\ O )!,ظ ;s LiM\d'ir# }aGS<\?Z`mYc#҄ a(y,sux&e :<1v1  R _o\0W_ Tx %$҃ be,L8t6)kK+p0c6RWT@HcZcJRL:n48G٧|3ݍ=V˷a0K 0 3JF7B;|r;7m(1C, #3*Ljn^dP9 `V2NeZDIPq33c++ڔ\|h V$aˍj>=2$M#c:WLj'4*m!CZ/]|(xgJi94Z,L+)VQ )Pxs݂B)F AրωO,jre+ dNf۠F$OP%" v~'9'(c-A3G s4ʑpM'uߎb:OO1kǖ0"^s^sS_) +ZJ!RObiAJfsƾ8L4þ0;tAYRQ=& '{(J֟*>aߍ0eBPbwQ@h)yo yT+ G͛TӅEyX'9pUgz UO C(1> 0R !T˷D_ 2ۍ#% mńi45E58eSO'6넖,,pbG|k/&!%G uv1JaCDžI5rۦ4 ':mA+f5 n2S݆Pb & M*kN8%`Pndxs`8>YƸA#rqg1c`0xR1-=M1l:̺h8PSI Kti\`#Yeci(5ƒ\h*~+Dc*pNgűd(] {*`ЊT}#፥À'c(+3hN]bִ`FZg81us^59BU%uJ|iAa H 3_GbOv21>K 'ϞC.8 O2WD$waX1h_{qf !$L/41p"L@'t9mm^e2ڼŤM25%na4?i\ƆLeb|:T6Ng>#`AWO³*To:b Nue3 -1o-Ȩ"}7"aB[rOՕ#s"}b,L!P%EW>o34X+0c+JxgSR ]ʧn1eXfn13-n5RoAAJp2jMBs=(1?7'yꌹG2yk-7q!iASPT=`c_=c(iLJe8Ѕ%~^ xΣPs9. V=,u-IIt1e(FUkCˆ4cS.V`@ٌKxJ8z[?(xUf'ӷ0*kJ81-.#ᯁ\ck21L ~m@ϒֹx63SAq>2i0MGGLdg Lo=, uye:5X(%0b\r 7Rdfk>c-9p45hin6d>]`?0 N\8qθָu$,R ]QE-1J|=¤ʻnӀ,5c5)/w})V cjSy[!d@Q3 q֜%51~?e)<ȭi}JDc2`0``10A A`0A A ?GՑ©@ *_ 50rJpX³?PeÅ 50bB3˖YJenҌ 3-ҾylQضw};vA8o 89>煒  O F& fX@i(k=n $;xDQli2h \.DbDOԒ6KDHIEIA?}`1m5o-?n ;wtf]{-f߲YnX @9YgUN#X~3bJ9Xeey|\d?QÌMrO_S8 YZf)-5GOq)kgW׷l\e?[]ojw0~d&zcs2|54iB1Xޚm{\MJ@He A VjiX4](#kmdm6K%|!3,q,]jSyx-[* EhM[T Sd~⻅3`Cu6〬|bA<껅Gf ZZiֆn@(>ky"/ jJc\4T#<:}-\6~ҍ2ǹw^O#[@^G2 S(IW. %\uk@+*:h)J}tlQ'yr44p;l]d`ha㈴S[[pJ Na6xį2XM@7uD5cLiX`TfV*cQնWv(5\#VsT2R84Ė-sh0*5b7T) S^[#Ro[nmM>tjNn"%@2@va,Gl;]J;Ge\, LNjNg]RL,jf}zX z2F}B{t:mml6PۧjI(ΕQW&cRIN@%Zq>4F+߾)jm~bED-QmNzw!dZ$e-ԙ_$Pr h87Mekew6^gwݵߵXBww%b4YF b 6|R )UIȉ"_qE[sLn.ԳoO=ÿnOoզi}[qoIvVwRYd6ݔ"64ァ}. G]}oo{k/s紽v==[|KeYI}ChWk͖n0!J)PH+sl"_S Ԑz~!>!I"ImT{2o[o${r+7-wmaJŖи{v}?wNN۸=ek;6}vpwL71;owv[pC xHLOME">sYVup )&dȨ!"fI>;Sr_{o{׵o7;I4-ՈvDY67/P{c{;ʽnsbܶkic={oPdK%+[[_OM X4}H4;Gntu&GLm9S'9ȵјҬ\]vw/CmB6 |k5&s1a]wMQ}oھ~,a/͵vC4zdGύԿ?Z=Oy{cq>;~[?S}6yn`6Rle,DN^/+Rr]ƒp+XARBү(A2A3֠pJM|RBI+)HWǥDJD=f}I=YoL* |};>}I#?{{ŗ'R鿢>}Owא^Oޠm%ۯd^ԬPm׵*"ıMbѥ6呰VT삇jYq$$MsU/5_ԶC J-$MJVg䥙 ( GϦL^O=طMϹ{c-86o=}j =+Kje$32凭]NTl?GlrϸvP7wmvG.-"ZG~ޑч櫨݃ƉBTSfJRJ\PH'zp^6CDԫid~f@PATDGvM?Jꧫreocכ&ٲ":xZ DfHIHGӗp/~k;<='yo vzEcc.$40@$ZS[;82$DqM9m55. VIpgA{7hzJ^{Yv?rn2ߢ/V{%/Z+2қ;c,Q$icXٽm5kl]vmkm1-pz%,tP5 MvNqԳo6ytVi%U7Ҙv9xޝ/ZxQe໧O;.[v |V ϵwɡ-ksnup EHJ6ٶ-}XofYa餒?V;¬Uid՚f |͈: be1) =cZwkKE7~b[K^Go\umƒE|!Νyk.ݽYU%mj{hG4:֕h$'H"e*HZKj$9,hWe tm]xķOjwl=f::qa{;|+ %pץ>viXvK|][G9*3 έik]>[nd)x<9J{[mUԕr57eU_b--6 nټ{y/Yi[;mDVتcHӻ!ޖHMfڷ]AZUV -Ť҃)),bT߈8WrEC`ԕ+|Ү8GQ;\}7>ԇh[;;pnw[I!Z]%$&a^:g]%fqАnHZ9TIרf]"BDp=0+ONqn֝qޝ֛ =)2#eXof}3jηyt,˶'mg)`,JcNcF7veR<-G0S)IS$I吏wVWnFԸ6knݻ;RqdYfHQF{W}0}.յ|Fcn osfӧS yZ(,Y6uX3˕"G|D@e>yzE憕*^RYnj㽽wz{ ;cw=sڷ}OfWӒDv[Fhi#2yN;{,{wi7+-8-"42"ݕ%l$8@ʲ(ǎuckSZY]ܥR AD)3K|{3N;;vNݻ'Mo}퍮^غخ-ol3"_-922$;䬯{OnK=foC^kM " ց!+.)H2*ƄV|ɇ{M n)+J5xTMw$ܯ~ ӝ߸mwg'ihV;+%=T,թ0Zpwzܛ7l>ʾN۵-betV$trIuV9'eHBeKPJ[j >ܲ qyPMfSʞiz%m5,anB$*JYGE=7M;{$_R;7]=@ڷHʺvݭAy{*@,!Sv_J=eo@J{s= ]OdRQ;wrVb쐽mZh,xvy;nmvj˽UE)K ^Br^g'R4GP_n'nv.p2S eGJf ';?Վ?P}xoQ}llpZ7ӱwfݐlޟ_uńd&mpruqsѼlmkgqY,V-;ܶP_c\,>Ђh% Ç49ֲEyͶʟ/pp=~{/NGt{hnܠQ6Vڄīs{s~X)8/9al[np蓼 u'W],*iSF3AN""Bl 4q_J=M)&l{j oKx!x-odUbм-ԍtm'7Cn]AZgRhVS:P dT+/!8HDt'iYn_1,Vyye2H:mem-ed03\pU,3Cq2" jX"5VӅˢtt[M @$e`+8gm5P1%+l+rOCNS_̽gq67I%Gݣ Ldr1ȶwuכOmnE6Xڐd%zq(&@?0:3fhH#}Y4-!0n/zG.J##5R\"in ,UT9P>j?lT%&]F{^myiRpƧ}[aw{yq dv"uL|ҊF͕hqwQHwp)L%YS[ʙ\&f|*蜶o}\m{rG{:OSk ̃ ksccH.:".HȓƙuhKsFQ(L5MC5wOnopowS:w+tDR05*p]ԲaR$ ,GaSʑ0=>0tebqv{CIb[J{eỷB~6Q:.{-n6ȋGv0ʘYO<sw)7BnTxT#^H([nnRh,YmVA%CIW(j<)v܎ DCV93iZS7y]HXAGmNP7 ̪E>nle=E5iVQFj1?n{o q9h`X$$֕My'iSyIR?0n.ԢVJJl[;c{TۯlJnFSƪueHX6mɫܱ-s[][<Q~jIF]5S8wn"H{c%PG.ZCol-5p nKNdL sӝL"z:Fm؛RӮsŻ[* 7$940\6)*RfOL"u[RRQ*y'21slz wf6er/;՞mD(.iՇT6M=V}RDg۷ FXS xwjZQJ$jNP:g)9s_|~%!4nThtbmqvw3םO һXN"*%ɤkMmܐQm@mm}rO-3EVD>a7)&m9P~tDΒ@!ƊI4H鍛o=4P\p_gz;{+3HhyJE :|ǿ>J6TwLoL=.XK> ۶ndMmmnni,N$y e߾ [-w ۙ@ )H -҉ռMr.-] Q̤rYcoI툷sܝ׷Z]ޖ/m,]ggQ42p$$WI*=m]ӯwvioaIll[ ^%sZxkme+.BDmzݽ$.}9w w9؆-4? WoDzSOlwgw.l{鿿;fgۍո'q,7MsC.!otW'&h^9+3  f31}i2 ̲HeJI5 [kpo_}yv?XiU.o;|0n7KpFxI*uFՋP} +sG^}>rϾ7К(͟"趂{iT@FaVk(P,ڤ\H(Ŗup݋m"̅$f ~@OOnU{xӳmbomoŏgyrM5[2=$e,aHg;{?nl=}q>zr|.;5h.>]ل΄3"gEֵhnaay0 J$E)Q2FU#,Di~խJRTӉ CPZ A) `/bov6v;oqK}a+[ nge%3ZңBn.տQ}Swk)Ef/k5N@ =: eISG~ībrUd%/NV Z­\LRV(ᚔRf9g9X}2l=սvYMl`wmaum˧5z( 9Ce6pv//ǽumC_T.}nBF,6-(`5YTVZ]0V[j$p2JXka?Pty"ISRyVT] ) g)>{ Ҿ}Dn0Kmz v[UtiC+PzNC~{A;#[飷7>ÿ6nc5=9vP&݇w-~RwVAJr?*cct#UƓv˟ܦ^ *I˖E!Q}Qj[.ꧢ=>[slwF춑nf;7X{$.њ6ݷҫ OD}Ek#u/J6lCa$ܶp()",RiNe7u7,[$$.hT9+,r V="YR3hҋNdNe)Lˆ!C2umsQ{gø/x[͡]meQVUuoa/_k=GWK{kzn.ݵ;rդnE$htZv[HmAI` J 322Mzgf Våys@ATǨ]sZcw7wkO۷7&ŎG# ?VdDHOͿS{;o/;k7վn{slh;QnۧCj=Os ]QY{VӚ n(RXR@RAp9*BCEl%>Kj ҦVԤAm4;lKiM=q%=]:Vr-٣W|o8V<~ѮзSH=47;w;ofmYmLnt-Ʃ%QTozHlyJJ+,'$K*rJ6ry'[Ե5Y\37[ZN)*@%ERRNLVd ϲs_^w |lv{ne["J9L|̄+>D|b5S1Rj*s㊘/-A U3V 0d偹V5ZnDSO,p譖 y?JTy%.&!n|QBG9BR5H23 VV_-k GP1pa\l.GZ|*sTZ )3*')gNֳFP3g3Chl?f (H>,8P (G kYqLR`1!]iKm5d* HO/hmvKÇyW(9vl)O$A* OHR1Q }oǿ6A# .m bT>iZ.|kjCHk$3B{W⼌R"d1e(+ABH+ka5MQ[9}ATP jǛpP,8$ )N3 ( \&XԫgNI6SkW<XJSi>)ʆµ:`k.sG,e:A}.c0T1P`0A.S } X1N<~X#6TUSʗ#*J|}`ſf5Ab `1 S`0A* A$``0` `-cIn 0` Z1,R Y(0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   1p*:{ $ΓG>$S402pbO81\t`  }w#r 6۔3 TT~8eR)}b5#zpbyse?g1gЈ0`d9## A33 }c>,$8D1L0`  0Fd`} 4? b3YpcX1P+1 >;6 JU0MO{&0( .wiK-1^yoQ1#,jtt* 9$Hi ;=TbQB|i8X咥!7d,HM%ΠIψi J{~4ۑLAZ4dJgR6 PVs[-8?& `=y1Cq.1jˑ4ʜxi5,Qa%SZg>Ӎ@$.&6<(@@JҴ5 aFnH+Sʴ @^`5h[\8Hot8҃9VMKuli 3iRS,tUlaS溥/yǣjA>nY^5Τƣ($ NII-Ja}/m'NӌfgJwO5bn_m3gta1xr~jW0!a/$RǔPYgʣLfa͇ՃTa@V8X3m+:7|q>fFDl-Ƈߍc@²T9p*Ex31,$` R1JxcR7ƊL}}0b 4j0I3eAk@ajy\.^1aasưR e+TeCʸܧ Ĺ-q|7& \IqH03--< O{ q +ʟ,VQxg1Hhii1‡c3٫o 6 L O5VjO\aTq"|0NBҪ't.UU\ +nPbx֙֔{0L #%a$0b_GvAxv7\ |' s>}8̀'O|f V?pJ.bpb*yiÆ5C<*IP`4?jl咶۾ a0A A`1  i0A AbTJK pRj`ŵoi+qM`x '#cZAKTXʜRĔcS" OnrXH*߶ Bu )\4iU$YzeF'"k+@"yf@U3$ʴjYAWl'tz޽}xwwn'kl[m}BE4EyYcz|˗|*XSZ1e>%jYB3(eIQ&x9b@G?!^7^=evKvw 3-ϐUP}1"#nmP_[-pfmm-6 3vi@to$7> ۺ=9|Ϸc}GٯRϹ] (`%Z9Y.-(@O4;K,;yg5f$-ē;L:Ze&X8TruIC( G;uuy4XQZXm,JG*kkR QQMj[P=[3Hm%FX6琼:v&۪QZ\>a[bڠRLPʼiㆤ:`3xm(vdH"3m4* 4MLM: A#hO|W pxpfG GVIʙ;w0vO,m7:s){PcZbU|+ #W@ȃL=p4N}QOFQ;xnPrMB0KAFD>]C/åmXy`9u&&kT@\^I^g;BdPu:jQ_5&Yšc 6xՏHZ:{Bbk{I>],A$!!iTi$1 |2'TפP̟fmǃ%m5w&5q +'W.6.v4 $r+.y5-Uq8 $\pз@³a׬GO50FL٘Pۋ.a:QZ?1(1β$" a͚{7F;A,5s5;X{!qghwyn}-4hoa +}Jh=黖?VԨ1@'MNu`I;do үSso^`>7lwxۻmk+.MXA9Hr1C,{Ƿsa >{k}c,v͛6H{g[:2sJcu+jjW?ُ̥©Äzo ZIYA?~^Tlnuok&ߞ]evZ$!#FX1ٻZ=ǵwKݯ%}V{Enm&)[HW]iK4n\0Uk0>e&x P6lnRdyyD)D*_çO|?vva[giN^mk۶_/unu[V*ہuWJ<5)wg,`=뺶n2[bY!u='N~Iۏ)ḩR 8܉d RL j=f5Dj(B NDnRqzJ_/駽;q۶n;7v띻6㱴xa gd1yiW['GܽSүNSS7N߰,f;c|^MqC۶hӫ$-Nm>ͯnJS ,|)G3^" Q3q醙4meлKQmG(!* X#1E g?㧶-~={T]Mg^+e/$W۫u'M1E#$1\u2Gc˻nw#c]Y;7qo{zR%KbvEZ|QKO4~}^Un\4N) iJȥ93JA^cmAHW[^tLOMFGInةNdfj*͕)ZҜP*4W~v}A}Mz7~l;ǭXϱѻz-W}7V߲6ỦؗZIIwО6B[]ja6K;^GjkwiXj3!j'>UzsT)(JU#5e 95\.Wy0BRV)%dsLMTc\`?];>k[ yR׵.=Gxl%cEgr 9Z-U_Soew^mVsQsIzyAomy_בۑ2:%gҴuP7L-M&7/(|yW R:UށeBЕ\!JFgV<)IΥP GK.ؾ/ߵoI[yq B [.gMכlQa,ԤK؝;z/mm݇ޥv~f{ӷL^6X?÷kg2DdgFn_kIe+U69 K. *BYs#u 98Xih%IP̉H ѝn[LwO ܞ]wGӝk`/T{6}]Enjv & dc+khN߷v)b8$o1Eh1PW9rJw)b'xtpmA_t!ʯyY&^* GܝG^nW ۏkwvgc$k&wQ4i#KDqƍ-==ѓvO.U}.a )1BQdd)TFެ͚@@PU&@(pd)V͜-*@19=9^{ǽ:.}Oڮ1PZOAqvq9UjF,F}*X"OM;{ښܭvG$#]C) SPF'losqf$FBI &ZՃԺ ֞pۻk6˻N4ڦ#Ķn=o`IdAN崻$. HLK884h?tʿRv]۱{|ٷ-K(n䅔 Td"S`Ϟxju-ܯ.,m^omc7KnR@m`zC(B$N eA4.J9#!-*3J_ D׷[n6]tEݹm;|6;D6]Hh髲#0,}Y)q>_zSݻqn;njv]j6]qwu B) A4%YōÖ]Kw i i\%J NBra %p,nmRt*IR|Y 3%6~v;׿MAwemu뵷=>~7%ZiER;ԍΰtcd;3w;Wٰ/vۥ6}U&/ѫjb5kbӮ4`#sH׏1 T)P'tE[ԟH;˟L}jN߽Ag{l$tܶ{l!-YF,%?ґ0闯{}mVvϱ>}qCanWv4QM,mmW׭N7 Pd%GROx4'5'k]'N]T%)(RR H 25K]z_7='RvV7ݷ7;ܴ]mYnZkf$**JBYnK+yB#r;y.gS+Ov+Id3dp_=qn);cpY{{mwA936-j ɧPC;׷v~Ip>ov[0Auц@Ρ5*nei_,d|W9eݾњTS l*dqHZ hV)>hS衤%*7Ƌkvϧ?Bd-;}_ QEB[6+-3.hF_ƫ̵qS>M7O)n(sN_mYJOK-҆PX/4\a j\t/H$^դH`2JF(s.\ejL03zcu))H?af K5͡tD:4Hȍt]LehTFeb^]CXfx&qvjwW+Df:%wjYmNN%.YC5HZ򮟄grZ?E mP4~Рr?F;N)ARv"nKi<`֋!n]B6]U: SYGS$K3Tf4Çl\ %̓1m[7*Y.$Mqtnn yXS4 75`I .$(dH W.id$z(\-N?Ä>}_!sow x1zWLDj*)c-L_fJw)& V7^+X0IHϗ= O#Ncq{3CuwkbcFG_0\E >lQH\n۫e1nNТ{77VPV D8b%% +C~kOG{Myu҃Y\klUK-(m{ڻnkwE{Xbٯus&Wp u8rn2|TvjYiyLO0 ^m{=}խvݳY j,/wm-RݢӣRםީegnz%^Xs]Vk2RTRd30.~V (W"?mp&ֱ1 d~]owonwo-.f.ɼ9mfޡPk(Ij1"Xc?Qئ+={#qUk]m޶oFd %dh*֬EP RPJ',TOxSH;+yՍH  n-B=dbݶD]lݳWVw/pc[^F;;IhTS_?ԏFsIwߤݷe7vIݼwެA+ o .-wWpykG%Vӵ;M) CN6Dd)̲Ny &be'#.]侤L %OLf[Q3OQ^Wx}ytI[ھܝem&VwĶIzbS*M>Ǯ';__$;YaK fмƍ6Jʽߠ.N@{*KIpQ+ ed H* &mo.?B 6RLn9W,V *HD{;P$=v~CgmV0-%vF)!vF~~H=o6=o۷6̛^gkٻeۮmzC*A+\% 'L&iFJ@"^_Tvvj}`䒉J[yҰ%KNR :OԿF~oV>o6{4/{Ve7=oʹ,Y++1ޠ\MqfpeW{=fw0v ȥYThNG*埋+e QI&'#8Ru'L2{ezM=m&b.ѡYQt>v.vۮ}rwvw5r5u}.eۢh7[(+tduٛW3 $!KB eC:B˕-ާZ.PhBJB ØI&QY~L뷨}ųw.ͲiARs[s-.cf67PE$ ˨mߠ?]^ػGrv;%{}Վ=?Y;=),9-B %,Ӿ-zب!$8dmejPJiIQs(e;D6yghi.Vp H$ LՁ>z/k[_ݼ^'u iK-M]p1틼$nQt)+͉}V^m lhznޡ}9KCiv}&{؍܁,6j 1fh v88--gBJHH>  MFtIg49R@R5uvMeh6핖2$۸;zTշrQmǵe;;ߥh6cvm}W#va=odm2!%S2jf+u HR((Fg2`jg QN0fܕ<@6 &IP&-MJ)%~F;COex]=ö{7 Ur/ϲ 8G4Waf[ϸm= Nޮ;ciލ|wGjjw-Ϳٻ_̳[YܴRnLvt o,V?75g-iR3fN :fzRp 8kV& % g#""}$[_wv Ӻm-x 5{Ɨ[pVIѰKRnMǵ3;˳;#dKrÿ +;oy׽wɽ˳9X&^Sࢁ!JT)RrbJT[j~+}T%I%Dyg\Ynovy_\?K( k{vc{a Ɉ$RDVml&۾=+?T=%Ch ;{csĻZ1m)wְE=VKm}ܱͭgeFkخmfe5i2g/^k} k.l=콣؝ު=Ѿ6GbǶm=f<]ؗ:א5di$/n}Gis)jS %Z3RUI#)2Rz3WGպsNJ R%L)(LL$A^Ǯ=Ȼvnn&{.K;[mo o#VBF=}i{?Pq]l ^/MK{>qmUzv( FI1^^ۮHI Jhepԭ|nT$۷5sڠv}%|1n[ʐ`+VIVM(9nv=o}1v==%{)}F$o轹 ]ɸ_4Q 3:8XëĹou BUSRBTrL%HDt[Q>{Mq$Vl ĬIHJ* R&#nIw~d}ݲ߸mcmwX&,]"M :6ַ3V;NϦ1'(7;d۬l6ج} \]6LBTf+!8HȤRI9>\df%6ۯv'w0p?M>cII*ʥ(t_ڷݶ /y`DF}Q5se]wleaO7M6۽qC6zmmͣ/e1Z#|hiiJ ! (TR8P&Uo^\%+B^ACA9NWJIB&JH!JI2P;Fmvm˙m]mbO{eWN]oPU?'n`vV}=tSi=_{Wp|o GzħXp#KYbNASXp'8B՞CMd!<[T (H͖9udXB4(z#DMDd)AZ^vm'tzu]i]vq%mVMrѪx%&!@VA(NBiH'"JX''$g\*3Uqn  lօj̩e @ʒm*o@TC0+VJ~^8_c6{nAsako=۽^86TxTi+K:HEiii![]Pʓ6[)xH[q^\8m f2NMŪԋwx%!2FSYj9˜Jf#^@my{ѓL`"u.4#*qdH8$`EH5݂N2'*qNߌt 0R?%,`h0q\bc W~̈$qI31)F 1u2ype@$sA qk}<`5 h1C"f&kR bb#0``a1L0`  Q~KO/~_v [5:`ſ=b#& Sk A`Ax 0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   ÀrP% e#2?v4O b/nx'1    `A? `xz81xNxSq- On5P`F7r ~Ƹ e (1_ۖ' s`8 b381BB1'A0bkdFX̣B(`3'" =e,()φ6 Y<~fPY 1((eCO*5"J"c"S}S54]j8unkBxԊs*@U%VsiO?q(%D2@T))%Y!ˮ-)d6?*hr3,nuUb9W !>YaJ 3ˆ^[vm81S;2Ne:wn~ 0Naw<+݆0bԓj> Dypb_w4H2g0} ;Ġ2 \lm01C5F`Abe34#.p&e8°1+1 Tn5U HVQ]>0 rMcu-yvϲ kqf g,'9/tq +}RCٴY#A|+Sˇ<g/l4|8LQH+@v1'X7( .}bTFj2ώXĦg,#UL &Ol<9\_O,cƂ]I2ی+I>~ 2VZ+kvq/'   s.9n9ҷxA&<Nn3G;bjIQd0՗ncyPxTT$R f՝?C5>nN{w@<Ǎ =C %LaN۠ <WqMp@'cb"ko2Z3ǔ4,1qv I̒O_~5c %k̳5{vtc6JBpb,V傆ZHlI2pOpƆSa-3k5isr?׾ PҕQZ裄k̥*}|\ۀxg8)RVR1DSSZ<)@q,3N0bH>ь7 F\ۺ ԥTJT)ξg Lz=s {~OoQv_;;pX>׻,bsGncC@2*iQkZGо^t!iZTӍ۴Rt*Vҍ#^Bm\ANܠKhq6*A>SD5fK n0ԯHn{~1[%ٶ>޸_0NMu{VRot}iAbcVտ65zM7=alXٖPzbyE&Nt[VtsCBD^4>m7 UZF ϩJn_;{jFx6w{d5lU:xc;>Wu>wmlFײ?/6Ym. q<֑#F:j$mkg1gEۈl$[!EE8/iTַL"=GaYzHl%/3,Nb꒚ em++Ziϩ4kO,_{hMnl~ʔgfnCH}ٛGo_kzߝ][/nͲiv_Ourm pjιV%ԭ*aiLU:kbv-ZSZaD.g70g*Di{{~z)'ݖ7li=X#WT2XG}C>6=~vhz=ٸo{bmSibіWiM,$wMY}zԎ8Xnh #)$H!3 HI]WG:tOJjzmn!JLiʀ@/1?O;ϴ~>snN#ޮwfil6 iZlŻ^DXZ˸_<$<6J+/韤> p;ϴ2{ɛuޭ{,l]m-k32 3csӚ\JsꦆtPZ&de#h^uz\򬀵 \\g\FQU?3}Jc͏۷N޹T%p'=o6 1cZܥQiX}5zm)ڽo;?vBwNݹnVlzKj/{1Xki܃)ZX49h/8ܨ0)u"EiJ-H\pb'ihDZrn9$B)ER^v/gW[u[t}Pnݙvm{Wtzo=\k܆"M;G7)>dɦ#f>bzoJvzn7as=*.^bmQr 4X'jڎ$$fq\8N%)O(*fVҴ{5\KH'g39Lgtilއ=zvgDz܎Z6p;r+HCJ@?Kպ自}2A6 ԬȐ$|ܨ@MWՖNy[,<)҄')N8b4XkuX}ЕQR'gD2}cXuoh7;h_돨wKqpݔX9^ДhS)$v+we_"E[[l/H*Xd xb.ˀXTF%,q J u % Jx:= Ekһ=;g]XMk$7oBҹq2;3t}E,.ׇeͷ韹S8MfD d* 1Ů oBPV\[>sbU:nfųwn%ٸƁxaٺO,<6ak߻_N/akn^473Be2TwM^Ћn}~kAnոIskp |+AqniP4r FT JbNaokp-B^T13̝Ws~}3LZX[cvgpQؘmlwQHu-ϷM|d =׵oe-6Vy/"K@QBы\C *IHL +~kbJR`~cWƱ/7탹{޺{ps⛕#qVb+*oUF/H]oܯۻmZ([n[ЀZ@Ŕ*'0TT*h*xNrkEwZkM|"TFn}J]wgװw |k/Vxow%m%Ru#U?_wžzvnr{:\m=c$1ԟ CFc##gٮtnKM]Q*+m~[ 4$$H3ݿacaw4{Vv7hmܶR]yw4ezn!f.nE|ʪ41tvSk@2~+ؚ\"g DwN}k8b>Ѵ 綵,W6l ujeTVi3 .M[8ERpYJ*8W|p +XoL>qsjכu݋[V&In3܂G.+Lq^4x֝޾v?|voɇ;nw&Qe'ญ VFfnt[ejv)dy!$9 ΥBe康sZ$,=qtݒZ{鯿;7l}8Ə{{jBj@2֪]@ twն~o6Ͻ[|$gwo /a4,rgWY$-oR[]J3 h Ƒ.HNot/5zPBk02C(Ϯ^,<;3G&^/M[s#XE>۸`;mntZ]neK43]ZK2j& ˥ʇ!8[Re2"Vp}\j Izyq6=i+ ;jrێZn^^X[\kKrA"Wy_M.=؉xmY/t/Y"RDtڀ#7Ob7mK#*R\&o4{o\*\%>_vV7[o[vHѸC"]dCq֏#.1/}9}J~ڷwmۻxnN;{_*ZW;iɨ=Awe{zTxn=ʅVۺ,bHֿ d]=*UizPs-H23P^jRzrmt(&s RܩwJܶiww_t}gٽlӽdk_ZlۋVHKc-6"BVfExO jj!ɢu<=oSG ?%wrm WtYi$6(7§ۭ$^jFȟO8 /iN7r|TD-.xNU5D!"'[Jg$`yy x3JVy'e! $a 3ݙlf33³u!6M:lHʦ{>X> Cp -*$O In;oⰵd";u\ӃzOLYHjUX#s>R$N>֒TbKZX#rO#ZWe`G%b4p '5o8Vkۜ*Cd W v7A%P ,f(R_L&]F•g*sDocw3spOrw}m&کmk ^]LP  A1KV4QC)2HPuMPLu]ll/3pTE"[bk-7QmەbUtdp*V~Mgw[._{>{}aޭr{z I!y=աhLI[Xt%ҔK3͘JIR +Z5;a P )@L@LK?[OWyrvm'{w7[{dd7pYedKۦ bS;џL{Wݻv~ݶ?PI=_WuߣI4O*\댋% yn%Li(M&?eTz740l Q39f۾woknqz-V}}o;=.FhduƥnXZU;qN^vT~[]Ma l1VўIoL m,ot[knJWݬAVG&$B$ȯ* La} flmBh[CQ%HSiJ3PTti;d}[~l>m>no/fo0n0nVv2#t*\qXBYvM=}^b޶ٻ{^'6Pͺm\+!zY%M!yҋ\)VT9JDֲQ>Vt5v4gfFYi*QJARi7迹oNlwko.7g#b˳=UZ.%$8˜N~~6v?6/M;;ʻӾ̾ W7Og`5R]2X35_O)- Zee ,ƣh^yPz=iזͭղVPV )$#Im]_Lŷ#`\&ǿwFlA?V);eY pн_;x]!.?zݮ{7{cpHUvߗC$zb-P-IŗV )5RIxUoa-uA`(RDJʒ|eSL5)oy={/ow߽;tkwzlClc#[,o ](."QX!A}׽ޭvקѴ?pkv{͍nȮ"agp,d E+#^a,TR^UxV8L NSM7P^q)r-9T h$֢iP"$;wgaknkܻ f[?yvY1噫dv/}@'zcaݯ;xwozMu==[NZA ղo{-D@q<ިn :TQY8F@)xd?SnW}-(6siPS,;fwtwZV|ی;, 9͢&$$]uHKsߩ}C~Y)ȾW)uzaoeI^ZQюoR^j\mRƔI_33aE&V O<:喹%Vu! _[T* KA,RX)nz$~yKnia.Iy[Ec&6Y!2$ot2p5=/>ͳ>z1;oov۾?d'kow{d%") n-PB#f?Qu[%[w<ֵIX$zHRzƵ->TZԗYT* ThT =madrcwzrw,R웤SI-*F F D=oՎ6=՞J,o7to{o[@M-:RV7۷gkbo!K9n\ r߫Qh֏ci) D\'¢%>?.AID*o=O;v˰Mcnoro{kgc%ſxnF/~K?hϤ~'}VY޶wvޙv:\n2lݧw,TIfvI־X{[Ln}6ts̀Ή9u\Wz}ݸʗqs2p8HI L!=[n\wdztvgeM`=o_8?oWUM_w׺G>ʂMI9-`^]* r<%ABŝعma` "IADQ&JVu[ڛlmnq^w^}k;׷lyѻ((NLw-Tz _XP^,~r/^q>na%_$ XAnqӝ6{k 3~SA[QlO0 S$YX#QNb-',BTVM"ڳa0Ӿ͆ gw}Rvw﷝} {L igsO; 7?OW>W>z.ɽvtݽowvt -d6]ر&2z,&拀:Lmaa`fs^|p$sʚ$=f31®si(9/2ږ#*Tv}w^evev,.6i۶w)$,WIl,fik.~pSKo_WmiR;Kvk{\O Gc5+ EVvlK{Sl8)yRNe*YB$yT*.n*VI:@IYP!JV,$KhXuM7n.q7pYnXfo#ICdeYZn%S՟T=TnǶv6mnڅڎovW-*2 cxq VMUZK,-\Rs%!J@(MKXmuΚ6қST E!% Vl12n7j6Bɒ,w-6ͻ\͍uR@5Rmg?gu{ͼzkl+V"$=}Wv2Bۥ\u%JJLbV7_ڭy BҲ2Y;;]tI{I v뱱?-k<١VX{QSWCNC.׾zqmvnؔ;Km=@ ҩр"M:<J' QD)(pH[@f3GˣZyu&*W2U3AS K+iwmGE,2[0^BYV7ö`}=Wܕ齺-QZbe.\GUht"6TVjdhU)@Lb8Ll,f|VSZ+$F{mI8[m"(%k]!A`y7tSkBL\\24NN4qKEʭ[Z dDRu ևYiԔ&D(H17X1QNg@ Biƹ,I>edjRV ` dN|T!t}`1BcRȀb3H0>G(4>b10H0k)1 Ac ι!KiID Y$O]e,?ߍa>`Ab# N Sb   OY`Ři A#jr`1CP` 0F`0A1'1L0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   0`   `E>gݍ . n,bPc90e0V80W`*S-cX0` Wf  3$0)(qO:%Bj?sۦ [)OLg9:?ۧ?)m i˟ s~ ЋÙ>㍼ ~;tAR:RkO xn+\y߹?Nn49iPZ%1`JW3YưS_`{}GیFy>ݺAß ;mC ި0A6ZP~3E' U^,50uAԒxqGc&r]0a@ 4qL S{qc҃ yQ NXoEuj(klLRb9&fRd( 1uX}wF*Wԩl\VsZtʦĒ !u@J+5jru_f54TיY1]#(g5(Lia-sI22V ^hy ߿%Ac>FAM}b$1LۄԨJ6mRtjAX \ߍȬe$z+׏T P̶4 c(x~51 +iiZV&Re -L(4<')Z~`+&E@-<\}@P#3hAy+^^=Čqּ~b\~x$!alˉ#^X.!]b8ƞix#yJGwGr2 )c*(<8ӂ5ca=3g;}b)ƿfy&e^>1sՁj51y.s"8cjf myΘj*9x־41B1JxɞnS>9X1qUADV[t:¤ݗߍC)Y-eԑ|ixs14yRFݠt Y@E$&DBC&G.QZ<=HL$x|DVzsƇ1CL/ҝ`Š? xW,a$ (R@|`żG5B@;l`(N\r9ra 4YF҃PXםUQ`j*E9ɢhV i4Te.E^n0 spKqn(%"`MJ 2@&S$ A3nO/nеw)wJ;s-/ڡ; m;k-k,qٷuDImYY~z@u鿦;"p54$ DwG5J__ - _9!҃"R|;W\}}3w06$ݖ;Kxc?g[O m/.ڳVPVmkn{᾿Y/4Vd($1J4rZS*"T @!Cka'˫|wrR xL,ww3n&w-#' #ԊՊFP I#1tO|5p g5͹ECt߇ݴHC:5T{`TOj뢊=qR┥+45s琕'.ve."hxZ+DتzP; $`XK3:`ƚ¯ÀƊm8`Jۄe$>_-'T7Ehڂ!o;8"w{ZPABTWĪaxQ5rUTʿgaY&C}L JC ,o*V;ֶͥIb 3ke*I4O)*Q7rYREm fGÐp%f>4j#Z熨BI0=f[aCՉ>:[m2fݯ醒PǸGYQ=E(̮ EE*9so/;["OpjQFǦ8~bt 0//67yIm 4w=]SXmɶ?qbIq[ݥmVG՟}}>ղ^3˻w~=o=SM͸vѻ"F͢2HJ]#dLԶn̕) W" qFR*]_C Q9PrRrDto~asW=W[m%I$D_t!iP,>;OM>}}}túحnܷm i.-դ$ĬҬh սYedț\m%+Zg*L}Iekr-ԅ8*3Zq1^nǰ;b]{xfSw 5)hK QUyKka;GuK PSK?Q6;ۻCq:[[iyVeYDTQn~/:imvZ(󹙳 昴P۲wJi  yКL$ DؿWwۆDxzۗwC;SjV;y_vna zYi^}EK}Ow}~^A|Wømm fY \Z2^wӾHmDmD>2!).*C42"]wM(7)CJ¿VJ4ff._}Ѿ{;Jeu%ٻ?`v:ah^h$$fm]1U$ϬߪY;BM}9 ?fe۽ՔtMr[IZH$MSTVޕ )a.?rԊIQĀZl"f,NXzsL-.^t!Jr)FJZlk{+Թgso.;[es쾙r/k6۲ٵ Es$vE5$D l~>ݻö!v݂[vv˺m`E}IU^+]>^,h.9^\.L +i @NdAmSt)dxPd@fIJI]٫wXOH}&!?Ql[Kx."ERB\]͋GkmK~wwgݑöXvdwWnnsE{wwKaqn]̐UdAzź?GÄB$!e`)2sEc25Ju6ȭG;I%KQ$ȒASz~= ^;W>ywߛ&,sGqomĈӍ.֨ʤm]rt/rL@j閗S#\k*c4:}#W{~~ fm=elT;f;)cyKv;Gr ҍdz;=98*HuԲcein-Zܬm-%JVqxe-OOq AI;ªj:ʅdU;#`;bݒ{=nGow hfh:3iƅs7^{op{۞豒gk[]ep7RN$E `A}CHxgrXH'C%h,moq?V[T™fVOˏqu; afh[w՝sv2Y-<D Hef[.{խv oe7fԛ.l xs,N LMBs *TPDUR&cuD3}NKmT~bP> ]K7`r݉͟w xl_Ee${,tBOFWTN1GMֿX7?D;Mf~;/$ݥ/v2Bx=~jL?uvRH!>Z7e+̶TIN\ɺz_EoJ7.eE(OM*s9'7)Gu}6z ~~7t/DMirؽilsJѮ#wK UM ʎ |wm{V2n6uhw9۴mFy[LphV5mY#W5ߺx2;DA!Xʂ B<ȐTJ~LXso-fF([#ģ>/\O$^ވoo;ڷRgxMo{ ;~z6˲wE]>iEhڢdd4V{Gv7wwk6|P^v|=LEGw!0Eԑ֥XMImSkuNHNXd ;|A݆>)emną(9:fN >;O=vKѾ6{j~F},6=&Rc Ƌմkj% \(_ Ȥ] "% yeV]|TZIjO.ɴ+= [9;bpiX[\Aeh2""#O.\F34q]JG8r IRNs4D.dOQmQ{ D}r jȯsˆ).UExǖҒR־rGvqo seKݕ#U LGVBqwk i.jPDƭsa w}t}PYEr‹a3T6eCn%T 1yi5resfbUAepB 8<>֠cK>nm匚M-ʋ"4˖ G#_<@6F3e= ji'2E_nLP0O![gZ5T7_m0ț^{oG|[e7gh-,jtҤa[e)TєJx+"BP}MyNQ9 b~'0gsnm݇w196-ͯs|$Hu52a4Vq  XxUͣR%ȑݾa>M[ݍvmJ %$! tflTQYr+)>aUJ|n'(VbRakڒKY`'wMK -4_`--u i4yT*AS&}d. ʛp=F0]6UݝAk%nyXh[T)Y|TMY :D`C ljsxwKg.e)iJ2$1,1m^%DU"~4J /hȯ.CUtKH H!jh o_Ё2v#o`ҷPb8)B*8cL*(*$ \1(ʋdo居f-[A_YIu$]C9WuLrH\%'۝$E^P+ yNpBVԗ,?t,1&Ӽ\!V5-7(d_RFbjFZZ]H4k<i :J&X$ S"-|7HFiݙgJrz>ֆm7dnZKY+^mt9gJ<1)Jk77m)TOqu}v=Ӷ/"'mEI ) VZSO$]5l 7ră\R&ld0@ue$,礼ۛT4pJ2={bmw_7]p} KY>~9Q¥k!Ъk-e~šT5]J@AJtNd8KWV}&[?qlV;om{W7Qs3Gjl5moޯFT3!a XʮJT>BNq:^i]2xvov&W]n|;n6Q9)lcy&_1H^F%AuQhOɲv{o=ptINUll{nGnY8d:Svnm]ԲGof]"dxh2+Y GlU龦2&)Q1e(G0;g{g?_6H\m!TdtO{QDeYH"E<+3w]v>o;^/hX'l{Lre{pZa{SMsjPnO VNkCezR.RRJBAM.4KB3WzPoI(nZRU" %TS`)YJJU{?\>Jd;-p@j$mo%Z\,bX]Ϧ;r߶&s[ooi-*kK5N{{6.'ϲa9k I<1 a,!%levK hJJLxAMJb}CNһ7JTT:1!E MDDL k.K;/g{;inorktmUSdhKj(-~Wн;omj/髵.C`; K}nQ՟[e7)LID9s`]佣#%ԕ D->Q\ jSIm7մQ߼). %HZdS* *S"FDLI#sca=߹G{zAޙz6=׾'x/~mz~HX ] aoz~вo}Y